S/MARt DB - S/MAR

AC  SM0000100
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  POT$STLS1-MAR
XX
OS  potato, Solanum tuberosum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  1419 bp
XX
DE  G001448; leaf/stem-specific protein LS1
DP  Direction: 3'; 295 - 1713; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  overlaps most of the coding sequence
XX
SQ  GAATTCCTTGTGATTTAGCTTTTAAGTCGTGACCTTATAAATAGTATATGAAATATTTTA
SQ  TGTTGTCGATGTATATATTCGTCAAACTCTTGGAAAAAGGTGCATATTTACTCATGTAGT
SQ  AATGACATGACTTAATTGTATCATCTGGTGTATTTTGGGGCTATATTTATACGCTTGTTG
SQ  TTAGCAAACCGTCTCGTATTTGTCCTTGATGTTAATTTGAGCTCTAGTTTAGATTGAGAG
SQ  GATTTCAGGTGTCAGAATACTTAAGTAAAAAAGTTCAAATTTACCTTAGCAACTTTGACT
SQ  ATGGTTTAACCAATTAATTACCTGCTAGTCTAATATACTTCAGATTGGAGCTATGTTAGG
SQ  GTCAAGGGCTAATATAAGACAATATGTTAACACAAGGATATGAATATCTGCTAAGTATAG
SQ  CGGAAGATAAAATTAAGATAATTGGTATAGAGAGAGAGAGAGAGAGAGAGTAGAGGTGCT
SQ  TTTAATCCTTGTTCTCTCAACTCTTTGATGAAAGCAGCTCGGTATACCAAGCATCCCATA
SQ  TTAGTAGGATACGAGAAAGGGCCACAGCCTAAGAGATGTGATGTAGACAATCTATCCTAA
SQ  TGCAAATTATGTCTATATATTTGAAAAAACCAGAGATAAAATATTGTAATGCAAAATTAA
SQ  TACTACCTGCTGATTATGAAGTGGGCTTTGTTACTAGGAATTAATGGAAGCATGGCCTTG
SQ  AGAGATGGCGTTGATGCCTCAGGCAGGAAGCCCAAGGTTTGTTTCTGCTTCTACCTTTGA
SQ  TATATATATAATAATTATCATTAATTAGTAGTAATATAATATTTCAAATATTTTTTTCAA
SQ  AATAAAAGAATGTAGTATATAGCAATTGCTTTTCTGTAGTTTATAAGTGTGTATATTTTA
SQ  ATTTATAACTTTTCTAATATATGACCAAAACATGGTGATGTTTAGGGAAAGGGTGTGTAC
SQ  CAATATGTTGACAAATATGGAGCTAATGTTGATGGATACAGGTTTGTTAAAAACTTCTTA
SQ  ATTTGTTTAATGTAATGCTTCACTAATAGAAAAATGAAACAAATAATCTAATACTTTGTG
SQ  TGATTTTGAAAATGCAGTCCCATCTACAACACAGATGAGTGGTCTCCAAGTGGTGATGTC
SQ  TATGTTGGAGGTATGACAATTTACTCGAACTTCCTTTTTTAACTCGAACTATGTATATAC
SQ  ACAACAACGTTAATAATTAAGTCGTACTCATTTTGAATCTACTGACTCTAGATCCTGATT
SQ  CACACATGTAATATAATTGCAGGTACTACTGGCTTAGCCATATGGGCCGTGACCTTGGTT
SQ  GGTATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGCACAGTAGATG
SQ  TTATCCTGTGTTGTACTATTTTAAGTTGTATTCGAGCTC
SC  EMBL #X04753; nt 1892-3310 (submitted by J. Bode)
XX
FT  1944 - 1949(EMBL): ATATTT-motif [2]
FT  1995 - 2000(EMBL): ATATTT-motif [2]
FT  2054 - 2059(EMBL): ATATTT-motif [2]
FT  2508 - 2513(EMBL): ATATTT-motif [2]
FT  2530 - 2535(EMBL): AAATAT-motif [2]
FT  2710 - 2715(EMBL): ATATTT-motif [2]
FT  2719 - 2724(EMBL): ATATTT-motif [2]
FT  2784 - 2789(EMBL): ATATTT-motif [2]
FT  2864 - 2869(EMBL): AAATAT-motif [2]
XX
SF  A/T-rich [2]; sites with similarity to topoisomerase II
SF  consensus [2]; oligo(dA) and oligo(dT) tracts >4 [2]
XX
BP  almost 100% [2]
XX
FF  augments promoter activity when placed at the 3' end of a
FF  reporter gene [4]
XX
EV  in vitro selection of S/MAR [2]
EP  1300 bp fragment comprising the first intron of the gene
XX
BF  SB000012; SATB1 [3]
MM  direct gel shift; 
SO  rec(human-ret lys); human
QA  6
BF  SB000012; SATB1 [3]
MM  gel shift competition; 
SO  rec(human-ret lys); human
QA  6
XX
DR  EMBL: X04753; STLS1G
XX
RN  [1]
RX  MEDLINE; 87203375 PubMed; 3575098
RA  Stockhaus, J., Eckes, P., Blau, A., Schell, J., Willmitzer,
RA  L.
RT  Organ-specific and dosage-dependent expression of a
RT  leaf/stem specific gene from potato after tagging and
RT  transfer into potato and tobacco plants
RL  Nucleic Acids Res. 15:3479-3491 (1987)
RN  [2]
RX  MEDLINE; 91027762 PubMed; 2223779
RA  Mielke, C., Kohwi, Y., Kohwi-Shigematsu, T., Bode, J.
RT  Hierarchical binding of DNA fragments derived from
RT  scaffold-attached regions: correlation of properties in
RT  vitro and function in vivo
RL  Biochemistry 29:7475-7485 (1990)
RN  [3]
RX  MEDLINE; 92370684 PubMed; 1505028
RA  Dickinson, L. A., Joh, T., Kohwi, Y., Kohwi-Shigematsu, T.
RT  A tissue-specific MAR/SAR DNA-binding protein with unusual
RT  binding site recognition
RL  Cell 70:631-645 (1992)
RN  [4]
RX  MEDLINE; 92205331 PubMed; 1553545
RA  Bode, J., Kohwi, Y., Dickinson, L., Joh, T., Klehr, D.,
RA  Mielke, C., Kohwi-Shigematsu, T.
RT  Biological significance of unwinding capability of nuclear
RT  matrix-associating DNAs
RL  Science 255:195-197 (1992)
RN  [5]
RX  MEDLINE; 98215708 PubMed; 9548713
RA  deBelle, I., Cai, S., Kohwi-Shigematsu, T.
RT  The genomic sequences bound to special AT-rich
RT  sequence-binding protein 1(SATB1) in vivo in Jurkat T cells
RT  are tightly associated with the nuclear matrix at the bases
RT  of the chromatin loops
RL  J. Cell Biol. 141:335-348 (1998)
//