S/MARt DB - S/MAR

AC  SM0000104
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 14:53:00 (updated); ili
XX
NA  RABBIT$Kappa-MAR
XX
OS  rabbit, Oryctolagus cuniculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; lagomorpha; leporidae
XX
HO  mouse, human-kappa MAR [2]
XX
DE  G000675; immunoglobulin kappa light chain
DP  Direction: 5'; Pos 1: enhancer
DN  Internal: y; 
DC  locates between joining and constant region [2]
XX
SQ  CCTTCCGTGGCCGTGCCATTTAGCTCCGTGGGGCCGTGTGCTGGCCGCTAAAGGCCACAG
SQ  CAGCCCCGCCACGAGCCTGTCTAACTCTGCAGTGGCCGGTTGTCCTGACACACAGTGATA
SQ  CAAATAATGCCACTAAGGGAAAGAGACTGTGGAGGACACGGAGCCAGCATGGGCGAAACA
SQ  GGGCAGAGGGGACTTCTTAGAAATTTCAGAAACAAAATCCATGTTCGCTATTTTATCCTC
SQ  TTACTGAAAACTTCCATTAGGGGACTATAAAGAATGATGTACTATTATTTCAATATCCTC
SQ  TTATCATGTTTATTTAAATTATGAAAGCTCAGTTCAAAAGAAAGAAGCATATTTATAAAT
SQ  TCTTTTATGGTAAAAACCACACCAGCAAAAAATCAAGTTTAATGGCAACAGTCTGGCCAC
SQ  TCAGATCTCGGTCAATTCACTAAATTTATATTAAATACCAGTAAGGTGTATTAACTAATA
SQ  AAAGTAAGGCAAGTACGTGGCATGTTGCTAATTTCAAAGATTTAGCTGCCTGGGCAGGAT
SQ  GACATTGCAGTTGTATAAAATATCTGCTCATGTATAACTGCAGTTAACAAAAACCAATAT
SQ  AACTGTATTTTTCAATACCTTAAGTCTGTGACAGAAAAACGTAAATCTAGATATTTTAAT
SQ  CCCATGGCCTCTAAAATAGTTTAATAATTTGTTGTTGCTGTTGTGCACCCCAGCTAATGT
SQ  CAAACATGATGTTTACGAAGGATTTTTTTGGTCTGCAATAGCTTGCTAGGGCTATTTTAG
SQ  GAACCTTTCAAAGCTCTTTTGAAACTAATTTAAACCTATGTAAAATGATTTAAACTGTTT
SQ  TAAACTATTTTAAAATTAATTTAGAGCCTTTTAAAAACTTTTAGAGACTTTTAAACTTTA
SQ  TTAAAAGCTAATGAGGCATCTTGAAATAATTTTTATATTAAAAATTAATTAAATCAAAAT
SQ  AAGATTAATATAATAATTTTATAATAGTTAAAAATAAAATATATTATTTCTACATTTTAT
SQ  ATTTATTTATATATACATAAAATTAATTAAATTTAATTTACATTAGAATTAATTAAATTA
SQ  AAATTTATTATTAAAGATTAGATTGCTAATTGTTTAAGATGTGAACGCCAGATGGAAAAT
SQ  GTAAAGCTCTCCAGGACTGCCCAGGCGGAAGGTCTTCACAGACCGCTCTTCCCTGCTCAG
SQ  GGGCTCGATCACAGTACTGTGCTGCCAAGTCCACTGTATACAGTTATGGGGGGGGGGGGC
SQ  TAATCATGAAGATTCAAAGAGGAACATAAAACAGGAAAGTTCACTGTCTTACACTGAACT
SQ  ACTTGGTTAC
SC  EMBL #K01360; nt 2518-3847
XX
SF  sequence similarty to its mouse and human homologs [2]
XX
FF  only present in the isotype K1 chain gene [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: K01360; OCIGKCA
DR  EMBL: X00231; OCIG04
XX
RN  [1]
RX  MEDLINE; 89315824 PubMed; 2546156
RA  Sperry, A. O., Blasquez, V. C., Garrard, W. T.
RT  Dysfunction of chromosomal llop attachment sites:
RT  Illegitimate recombination linked to matrix association
RT  regions and topoisomerase II
RL  Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989)
RN  [2]
RX  MEDLINE; 93027217 PubMed; 1408808
RA  Whitehurst, C., Henney, H.R., Max, E.E., Schroeder, H.W.,
RA  Stuber, F., Siminovitch, K., Garrard, W.T.
RT  Nucleotide sequence of the intron of the germline human K
RT  immunoglobulin gene connecting the J and C regions reveals
RT  a matrix association region (MAR) next to the enhancer
RL  Nucleic Acids Res. 20:4929-4930 (1992)
//