S/MARt DB - S/MAR

AC  SM0000105
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  MOUSE$L2a
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  100 bp
XX
DE  G001348; 
DP  Direction: 5'; 4500 - ; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DE  G001349; 
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1

G001349;
G001348;

XX
SQ  GAAAAACCAAAATAAATAAATAAATAATCATAAGGATAAAGCTCACCCTAGGGTGCCTTA
SQ  TTTATTTTTCTATTACTGTGATAAAACACCATGACCAAGG
SC  [1]
XX
FT  11 - 25(EMBL): L site [1]
FT  57 - 75(EMBL): S site [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from murine EL-4 T cell line
XX
BF  SB000001; SATB1 [1]
MM  direct gel shift; 
SO  VL3; mouse
QA  6
BF  SB000001; SATB1 [1]
MM  supershift (antibody binding); 
SO  VL3; mouse
QA  6
BF  SB000001; SATB1 [1]
MM  replacement by distamycin A; 
SO  VL3; mouse
QA  6
BF  SB000024; SATB1 [1]
MM  direct gel shift; 
SO  thymus; calf
QA  6
BF  SB000024; SATB1 [1]
MM  supershift (antibody binding); 
SO  thymus; calf
QA  6
BF  SB000025; CDP [1]
MM  direct gel shift; 
SO  VL3; mouse
QA  6
BF  SB000025; CDP [1]
MM  supershift (antibody binding); 
SO  VL3; mouse
QA  6
BF  SB000025; CDP [1]
MM  replacement by distamycin A; 
SO  VL3; mouse
QA  6
XX
RN  [1]
RX  MEDLINE; 97364778 PubMed; 9218488
RA  Banan, M., Rojas, I. C., Lee, W. H., King, H. L., Harriss,
RA  J.V., Kobayashi, R., Web, C. F., Gottlieb, P. D.
RT  Interaction of the nuclear matrix-associated region
RT  (MAR)-binding proteins, SATB1 and CDP/Cux, with a MAR
RT  element (L2a) in an upstream regulatory region of the mouse
RT  CD8a gene
RL  J. Biol. Chem. 272:18440-18452 (1997)
//