S/MARt DB - S/MAR

AC  SM0000106
XX
DT  1.1.1999 00:00:00 (created); ili
DT  27.2.2002 15:05:00 (updated); ili
XX
NA  MMTV$LTR
XX
OS  MMTV, mouse mammary tumor virus
OC  viridae; ss-RNA enveloped viruses; positive strand RNA
OC  viruses; retroviridae; oncovirinae; type C oncovirus group;
OC  mammalian type C oncoviruses
XX
SZ  118 bp
XX
DE  G000455; mouse mammary tumor virus
DP  Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  proximal negative regulatory element (pNRE) within the LTR
DC  of MMTV

G000455;
mouse mammary tumor virus

XX
SQ  CGACATGAAACAACAGGTACATGATTATATTTATCTAGGAACAGGAATGCACTTTTGGGG
SQ  AAAGATTTTCCATACCAAGGAGGGGACAGTGGCTGGACTAATAGAACATTATTCTGCA
SC  EMBL #AF228552; nt 814-931
XX
FT  94 - 118: important for SATB1 binding [1] [2]
XX
FF  SATB1 and Cux/CDP binding [2] [3]
XX
EV  in vitro selection of S/MAR [2]
EC  matrix from Jurkat cells and from CCL-64 mink lung cells
XX
BF  SB000026; SATB1 [2]
MM  direct gel shift; 
PR  (GACTAATAGAACATTATTCTGC)4
SO  thymus; rat
QA  6
BF  SB000026; SATB1 [2]
MM  supershift (antibody binding); 
PR  (GACTAATAGAACATTATTCTGC)4
SO  thymus; rat
QA  6
BF  SB000080; SATB1 [2]
MM  direct gel shift; 
SO  CCL64; mink
QA  6
BF  SB000080; SATB1 [2]
MM  supershift (antibody binding); 
SO  CCL64; mink
QA  6
BF  SB000081; CDP [2]
MM  direct gel shift; 
PR  (GACTAATAGAACATTATTCTGC)4
SO  CCL64; mink
QA  6
BF  SB000081; CDP [2]
MM  supershift (antibody binding); 
PR  (GACTAATAGAACATTATTCTGC)4
SO  CCL64; mink
QA  6
XX
DR  EMBL: AF228552; AF228552
XX
RN  [1]
RX  MEDLINE; 96079036 PubMed; 7494299
RA  Bramblett, D., Hsu, C. L., Lozano, M., Earnest, K.,
RA  Fabritius, C., Dudley, J.
RT  A redundant nuclear protein binding site contributes to
RT  negative regulation of the mouse mammary tumor virus long
RT  terminal repeat
RL  J. Virol. 69:7868-7876 (1995)
RN  [2]
RX  MEDLINE; 97415606 PubMed; 9271405
RA  Liu, J., Bramblett, D., Zhu, Q., Lzano, M., Kobayashi, R.,
RA  Ross, S. R., Dudley, J. R.
RT  The matrix attachment region-binding protein SATB1
RT  participates in negative regulation of tissue-specific gene
RT  expression
RL  Mol. Cell. Biol. 17:5275-5287 (1997)
RN  [3]
RX  MEDLINE; 99303784 PubMed; 10373541
RA  Liu, J., Barnett, A., Neufeld, E. J., Dudley, J. P.
RT  Homeoproteins CDP and SATB1interact: potential for
RT  tissue-specific regulation
RL  Mol. Cell. Biol. 19:4918-4926 (1999)
//