S/MARt DB - S/MAR

AC  SM0000107
XX
DT  1.1.1999 00:00:00 (created); ili
DT  26.6.2002 14:53:00 (updated); ili
XX
NA  HS$apoB-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  665 bp
XX
LO  2p24-p23
DE  G000205; apolipoprotein B
DP  Direction: 3'; 43186 - 43850
DN  Internal: n; Gene position numeral: -1
DC  numbering system from Ludwig et al., DNA 6: 363-372 (1987)
DC  was used [1]

G000205;
apolipoprotein B

XX
SQ  AAAAAGATGAGGTAATTGTGTTTTTATAATTAAATATTTTATAATTAAAATATTTATAAT
SQ  TAAAATATTTATAATTAAATATTTTATAATTAAAATATTTATAATTAAATATTTTATAAT
SQ  TAAAATATTTATAATTAAATATTTTATAATTAAAATGTTTATAATTAAATATTTTATAAT
SQ  TAAAATGTTTATAATTACATATTTTATAATTAAAATGTTTATAATTACATATTTTATAAT
SQ  TAAAATGTTTATAATTACATATTTTATAATTACATATTTTATAAAGTATTTATAATTACA
SQ  TATTTTATAATTAAAGTATTTATAATTACATATTTTATAATTAAAGTATTTATAATTACA
SQ  TATTTTATAATTCAATATTTTATAAATAGTTAAAAAGACGAGGAAAAAATTAAAAAGACG
SQ  AGGTTATTGATCTCAGGAATTGTATTTGCCAAGTGAGAAGGAAAAAATATTCACAAAGGC
SQ  TTGTA
SC  EMBL #J05157
XX
FT  33 - 40(EMBL): AATATTTT motif [1]
FT  78 - 85(EMBL): AATATTTT motif [1]
FT  108 - 115(EMBL): AATATTTT motif [1]
FT  168 - 175(EMBL): AATATTTT motif [1]
FT  198 - 205(EMBL): AATATTTT motif [1]
FT  228 - 235(EMBL): AATATTTT motif [1]
FT  258 - 265(EMBL): AATATTTT motif [1]
FT  288 - 295(EMBL): AATATTTT motif [1]
XX
SF  ATATTT motif, repeated 16 times [1]
XX
CH  border of the DNase I-sensitive domain [1]; has insulator activity in Drosophila [5]
XX
FF  hypervariable region [1]; confers insulator activity to
FF  single copy transgenes [3] [4]; contains centered
FF  liver and colon specific DNase I hypersensitive site (DH 1)
FF  [2]; orderd nucleosome organization [2]; target of
FF  the newly developed DNA-reactive drug bizelesin [6]
XX
CP  HepG2, CaCo-2 & HeLa [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrices from HeLa, HepG2 & CaCo-2 cell lines
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: J05157; HSAPOBXA
DR  EMBL: X04682; HSAPOB3
XX
RN  [1]
RX  MEDLINE; 90078221 PubMed; 2592370
RA  Levy-Wilson, B., Fortier, C.
RT  The limits of the DNase I-sensitive domain of the human
RT  apolipoprotein B gene coincide with the locations of
RT  chromosomal anchorage loops and define the 5' and 3'
RT  boundaries of the gene
RL  J. Biol. Chem. 264:21196-21204 (1989)
RN  [2]
RX  MEDLINE; 90365697 PubMed; 2168168
RA  Levy-Wilson, B.
RT  DNaseI hypersensitive sites at the 3' end of the human
RT  apolipoprotein B gene
RL  Biochem. Biophys. Res. Commun. 171:162-168 (1990)
RN  [3]
RX  MEDLINE; 95097992 PubMed; 7799927
RA  Kalos, M., Fournier, R. E.
RT  Position-independent transgene expression mediated by
RT  boundary elements from the apolipoprotein B chromatin domain
RL  Mol. Cell. Biol. 15:198-207 (1995)
RN  [4]
RX  MEDLINE; 98187656 PubMed; 9528807
RA  Namciu, S. J., Blochinger, K. B., Fournier, R. E. K.
RT  Human matrix attachment regions insulate transgene
RT  expression from chromosomal position effects in Drosophila
RT  melanogsaster
RL  Mol. Cell. Biol. 18:2382-2391 (1998)
RN  [5]
RX  MEDLINE; 21285755 PubMed; 11389587
RA  Antes, T. J., Namciu, S. J., Fournier, R. E., Levy-Wilson,
RA  B.
RT  The 5' boundary of the human apolipoprotein b chromatin
RT  domain in intestinal cells
RL  Biochemistry 40:6731-6742 (2001)
RN  [6]
RX  MEDLINE; 21538773 PubMed; 11487576
RA  Woynarowski, J. M., Trevino, A. V., Rodriguez, K. A.,
RA  Hardies, S. C., Benham. C. J.
RT  AT-rich islands in genomic DNA as a novel target for
RT  AT-specific DNA-reactive antitumor drugs
RL  J. Biol. Chem. 276:40555-40566 (2001)
//