S/MARt DB - S/MAR

AC  SM0000110
XX
DT  1.1.1999 00:00:00 (created); ili
XX
NA  DROME$anon-MAR
XX
SY  anonymous-M/SAR, anonymous-S/MAR, 
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  1327 bp
XX
LO  chromocenter, 2R
XX
SQ  GAATTCCTTGAAATCGTCTTCGACGAACACGCGGCTCAGCTCGCGGGCGCGGTCGGCCGG
SQ  GAAGTTCATGAACACCACCGCGTCGCCGTCTTCAACCTTGACCGGCTCGCCGATGGTGGT
SQ  GGCTTTGACGAATTCTCTTTGGCATGTAGGTGTTTTTGATTTGTGTAGTCTGTGTGTTGT
SQ  ACTTAAAAATATGGTATATGTGTTATTGTGCTTATATACTTTTGTATACGTGTACCTATA
SQ  TGTTGTGTATATGTTTAGTGTAATGTTTTAGCTTAAATAATAAGGTGTAATTAAGTAATT
SQ  GTAATCTTATATATAGATAATCTTAAAATGTAGTGTGTATTTATAATATGAATCCGTTTG
SQ  TTTCTTTCTAAGTAAGTGTTGGCTCCAATGTTTGACTGTAATATATTATGTACATTAGTA
SQ  AGTATAAAAAATTTATATTCAGTTTGTATAAGTAAATGAACACATGGCAGTAACACAATC
SQ  CGAAGTAGTAAGTTGAGTGTATTTGTAATTTGACAAATGTTTCTCAATTGGGAGCATTCG
SQ  CGAACAAGTATATGGCTTTCAAGGAAAGGTTCAACCTGACACACATAGTGATTTTATTAC
SQ  TGATTTATTGTTTAATTTCTTTCAATGTTGTGGTCCCGGTGCCTTTTCAGCGATTGATGT
SQ  ACACATATTCGGCCACAACATTGAACTAGATTTATTTGTTTTGCTTATTTATGTATGGTC
SQ  CCGGTGTCCATCAGCGATTGATGTACACATATTTGGCCATAGCACTGAATGATGTTAACT
SQ  TTTTATGTATATCATAAGTGATCCCGGTGCCCTTTCAGCGATTGATGTGCACATATTCGG
SQ  TCACTTTGAATGTAAAGACATTTTTTTTATGTGTGATCCCGGTGCCCTTTCAGCGATTGA
SQ  TGTGCACATATTCGGTCACAATAGTTTTGTAATTATACTGTATGTCACTGTTGAACTTGT
SQ  TTGTGTGAAGTTTTTTCCTTTTCTTCTCTTTTTTTTGAGAACCACATATTTACACTGGCT
SQ  CCTCAAACTTGTGTTTTTTTTTTTCTGCCACTTGTTCACTCACTTGCCCGTTTACAGAAG
SQ  TGGAACGAAGAACGTGAAAGGCGTTGTTAATCCTTTTAGTTCTAGTCCCGTGCGCCAGTT
SQ  ACGGGTGCCTCCGTTGGATCGGGGATCCTCCTTTCTCTACTCTTAGTTAGTTGCTGCCCA
SQ  GGCTGATGTGATGGGAGTCAATAATGACTTTATTGTGTACTTATGATATATGTAGGTTAT
SQ  ATATATTTGCCACTTTAAATAAATCAACTGCTCGGTTTGGTGTCAAGATCAAGAATGATG
SQ  AAAGCTT
SC  EMBL #Z37541
XX
FT  350 - 1010(EMBL): lamin binding [1]
FT  601 - 681(EMBL): tandem repeat [1]
FT  681 - 765(EMBL): tandem repeat [1]
FT  766 - 844(EMBL): tandem repeat [1]
FT  845 - 919(EMBL): tandem repeat [1]
XX
SF  tandem repeats contain motifs similar to Drosophila
SF  topoisomerase II site [1]
XX
FF  copurifies with nuclear matrix [1]; in vivo binding may
FF  be dependant on the copy number of the sequence [1]
XX
BF  SB000027; Lam-Dm0 [1]
MM  sedimentation assay; 
SO  rec(Drosophila-E.coli); fruit fly, Drosophila melanogaster
QA  6
XX
DR  EMBL: Z37541; DMCBHETLA
XX
RN  [1]
RX  MEDLINE; 96257215 PubMed; 8666268
RA  Baricheva, E. A., Berrios, M., Bogachev, S. S., Borisevich,
RA  I. V., Lapik, E. R., Sharakhov, I. V., Stuurman, N.,
RA  Fisher, P. A.
RT  DNA from the Drosophila melanogaster beta-heterochromatin
RT  binds specifically to nuclear lamins in vitro and to the
RT  nuclear envelope in situ
RL  Gene 171:171-176 (1996)
//