S/MARt DB - S/MAR

AC  SM0000114
XX
DT  15.1.1999 11:54:42 (created); ili
DT  26.6.2002 14:54:00 (updated); ili
XX
NA  HS$CMYC-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1401 bp
XX
LO  8q24
DE  G000221; 
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
DC  MAR contains a part of exon 3 of the c-myc gene [1]
XX
SQ  CGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACC
SQ  TTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGT
SQ  CTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGC
SQ  CAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATG
SQ  CACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTT
SQ  GGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCC
SQ  GGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATA
SQ  CATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAA
SQ  ACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAA
SQ  AGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTT
SQ  CAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAGTCTTGAGACTGAAAGATTTA
SQ  GCCATAATGTAAACTGCCTCAAATTGGACTTTGGGCATAAAAGAACTTTTTTATGCTTAC
SQ  CATCTTTTTTTTTTCTTTAACAGATTTGTATTTAAGAATTGTTTTTAAAAAATTTTAAGA
SQ  TTTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAACTTTAATAAAACGTT
SQ  TATAGCAGTTACACAGAATTTCAATCCTAGTATATAGTACCTAGTATTATAGGTACTATA
SQ  AACCCTAATTTTTTTTATTTAAGTACATTTTGCTTTTTAAAGTTGATTTTTTTCTATTGT
SQ  TTTTAGAAAAAATAAAATAACTGGCAAATATATCATTGAGCCAAATCTTAAGTTGTGAAT
SQ  GTTTTGTTTCGTTTCTTCCCCCTCCCAACCACCACCATCCCTGTTTGTTTTCATCAATTG
SQ  CCCCTTCAGAGGGCGGTCTTAAGAAAGGCAAGAGTTTTCCTCTGTTGAAATGGGTCTGGG
SQ  GGCCTTAAGGTCTTTAAGTTCTTGGAGGTTCTAAGATGCTTCCTGGAGACTATGATAACA
SQ  GCCAGAGTTGACAGTTAGAAGGAATGGCAGAAGGCAGGTGAGAAGGTGAGAGGTAGGCAA
SQ  AGGAGATACAAGAGGTCAAAGGTAGCAGTTAAGTACACAAAGAGGCATAAGGACTGGGGA
SQ  GTTGGGAGGAAGGTGAGGAAGAAACTCCTGTTACTTTAGTTAACCAGTGCCAGTCCCCTG
SQ  CTCACTCCAAACCCAGGAATT
SC  EMBL #X00364; nt 6682-8082
XX
FT  7448 - 7619(EMBL): major attachment region [1]
FT  7472 - 7521(EMBL): p25 binding [1]
FT  7511 - 7516(EMBL): polyA signal
FT  7537 - 7553(EMBL): p25 binding [1]
FT  7652 - 7657(EMBL): polyA signal
XX
SF  T boxes [1]; motifs similar to Drosophila topoisomerase
SF  II consensus [1]
XX
FF  affinity for nuclear martix form differentiated cells is
FF  geater than for nuclear matrix from undifferentiatied
FF  (untreated) cells [2]; no binding of hnRNP-U SB000017
FF  or p300 SB000089 in cells transfromed with adenovirus or
FF  SV40 [4]; target of the newly developed DNA-reactive
FF  drug bizelesin [3]
XX
CP  HL-60 [1] [2]
XX
EV  in vitro selection of S/MAR [1]
EC  matrices from HL-60 cells
EV  in vivo selection/high salt [1]
XX
BF  SB000017; hnRNP-U [4]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
BF  SB000032; p25 [1]
MM  DNase I footprinting; 
PR  172 bp Dra I-Dra I fragment
SO  HL-60-; human
QA  6
BF  SB000032; p25 [1]
MM  direct gel shift; 
PR  172 bp Dra I-Dra I fragment
SO  HL-60-; human
QA  6
BF  SB000032; p25 [1]
MM  gel shift competition; 
PR  172 bp Dra I-Dra I fragment
SO  HL-60-; human
QA  6
BF  SB000089; p300 [4]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
XX
DR  EMBL: X00364; HSMYCC
XX
RN  [1]
RX  MEDLINE; 90242305 PubMed; 2185883
RA  Chou, R. H., Churchill, J. R., Flubacher, M. M., Mapstone,
RA  D. E., Jones, J.
RT  Identification of a nuclear matrix-associated region of the
RT  c-myc protooncogene and its recognition by a nuclear
RT  protein in the human leukemia HL-60 cell line
RL  Cancer Res. 50:3199-3206 (1990)
RN  [2]
RX  MEDLINE; 92025953 PubMed; 1927975
RA  Chou, R. H., Churchill, J. R., Mapstone, D. E., Flubacher,
RA  M. M.
RT  Sequence-specific binding of a c-myc
RT  nuclear-matrix-associated region shows increased nuclear
RT  matrix retention after leukemic cell (HL-60) differentiation
RL  Am. J. Anat. 191:312-320 (1991)
RN  [3]
RX  MEDLINE; 21538773 PubMed; 11487576
RA  Woynarowski, J. M., Trevino, A. V., Rodriguez, K. A.,
RA  Hardies, S. C., Benham. C. J.
RT  AT-rich islands in genomic DNA as a novel target for
RT  AT-specific DNA-reactive antitumor drugs
RL  J. Biol. Chem. 276:40555-40566 (2001)
RN  [4]
RX  MEDLINE; 21907223 PubMed; 11909954
RA  Martens, J. H. A., Verlaan, M., Kalkhoven, E., Dorsman, J.
RA  C., Zantema, A.
RT  Scaffold/matrix attachment region elements interact with a
RT  p300-scaffold attachment factor A complex and are bound by
RT  acetylated nucleosomes
RL  Mol. Cell. Biol. 22:2598-2606 (2002)
//