S/MARt DB - S/MAR

AC  SM0000115
XX
DT  21.1.1999 14:40:24 (created); ili
XX
NA  Y$H4-ARS
XX
OS  yeast, Saccharomyces cerevisiae
OC  Eukaryota; Fungi; Ascomycota; Hemiascomycetes;
OC  Saccharomycetales; Saccharomycetaceae; Saccharomyces.
XX
SZ  140 bp
XX
DE  G001406; histone 4
DP  Direction: 3'; 293 - 
DN  Internal: n; Gene position numeral: -1
DC  293 bp downstream from copy-I H4 gene [1] [3]

G001406;
histone 4

XX
SQ  TTTACTCTGTGTTTATTTATTTTTATGTTTTGTATTTGGATTTTAGAAAGTAAATAAAGA
SQ  AGGTAGAAGAGTTACGGAATGAAGAAAAAAAAATAAACAAAGGTTTAAAAAATTTCAACA
SQ  AAAAGCGTACTTTACATATA
SC  EMBL #M13626
XX
FT  21 - 31(EMBL): core consensus sequence that is required but
FT                 not sufficient for ARS function [1]
XX
SF  AT-rich sequence is the preferred site of helix unwinding
SF  [2]
XX
FF  ARS [2]
XX
BF  SB000012; SATB1 [4]
MM  direct gel shift; 
PR  400 bp fragment containing H4 ARS
SO  rec(human-ret lys); human
QA  6
BF  SB000012; SATB1 [4]
MM  gel shift competition; 
PR  400 bp fragment containing H4 ARS
SO  rec(human-ret lys); human
QA  6
BF  SB000046; ACBP [3]
MM  direct gel shift; 
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000046; ACBP [3]
MM  gel shift competition; 
PR  T-rich strand of the ARS oligonucleotide
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000046; ACBP [3]
MM  southwestern blotting; 
PR  T-rich strand of the ARS oligonucleotide
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000046; ACBP [3]
MM  UV-crosslinking; 
PR  T-rich strand of the ARS oligonucleotide
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
XX
DR  EMBL: M13626; SCARSA
XX
RN  [1]
RX  MEDLINE; 87064532 PubMed; 3023929
RA  Bouton, A. H., Smith, M. M.
RT  fine-structure analysis of the DNA sequence requirements
RT  for autonomous replication of Scaccharomyces cerevisiae
RT  plasmids
RL  Mol. Cell. Biol. 6:2354-2363 (1986)
RN  [2]
RX  MEDLINE; 88135771 PubMed; 2830028
RA  Umek, R. M., Kowalski, D.
RT  The ease of DNA unwinding as a determinant of initiation at
RT  yeast replication origins
RL  Cell 52:559-567 (1988)
RN  [3]
RX  MEDLINE; 91160059 PubMed; 2001590
RA  Hofmann, J. F., Gasser, S. M.
RT  Identification and purification of a protein that binds the
RT  yeast ARS consensus sequence
RL  Cell 64:951-960 (1991)
RN  [4]
RX  MEDLINE; 92370684 PubMed; 1505028
RA  Dickinson, L. A., Joh, T., Kohwi, Y., Kohwi-Shigematsu, T.
RT  A tissue-specific MAR/SAR DNA-binding protein with unusual
RT  binding site recognition
RL  Cell 70:631-645 (1992)
//