S/MARt DB - S/MAR

AC  SM0000116
XX
DT  28.1.1999 13:16:56 (created); ili
DT  27.2.2002 17:52:00 (updated); ili
XX
NA  HS$PARP-3MAR
XX
SY  K28 MAR, MAR 28, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  393 bp
XX
LO  1q41-q42
DE  G001407; poly (ADP-ribose) polymerase
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; 
DC  locates to the 3' untranslated region of the respective
DC  cDNA [1]
XX
SQ  ACCCGAAGCGCTTCTGCACCAACTCACCTGGCCGCTAAGTTGCTGATGGGTAGTACCTGT
SQ  ACTAAACCACCTCAGAAAGGATTTTACAGAAACGTGTTAAAGGTTTTCTCTAACTTCTCA
SQ  AGTCCCTTGTTTTGTGTTGTGTCTGTGGGGAGGGGTTGTTTTGGGGTTGTTTTTGTTTTT
SQ  TCTTGCCAGGTAGATAAAACTGACATAGAGAAAAGGCTGGAGAGAGATTCTGTTGCATAG
SQ  ACTAGTCCTATGGAAAAAACCAAGCTTCGTTAGAATGTCTGCCTTACTGGTTTCCCCAGG
SQ  GAAGGAAAAATACACTTCCACCCTTTTTTCTAAGTGTTCGTCTTTAGTTTTGATTTTGGA
SQ  AAGATGTTAAGCATTTATTTTTAGTTAAAACCC
SC  EMBL #M32721; nt 3245-3641, edited according to [1]
XX
FT  12 - 50: palindrome [1]
FT  17 - 22: similarity to CAT box [1]
FT  23 - 29: putative GAGA factor binding site [1]
FT  30 - 34: similaity to SV40 ORI [1]
FT  46 - 51: similarity to CAT box [1]
FT  63 - 86: kinked DNA [1]
FT  81 - 87: similar motif found in chicken lysozyme MAR
FT             SM0000031 [1]
FT  82 - 118: curved DNA [1]
FT  84 - 113: palindrome [1]
FT  102 - 107: putative binding site for Ubx [1]
FT  127 - 174: curved DNA [1]
FT  127 - 140: putative binding sites for Ubx [1]
FT  146 - 175: kinked DNA [1]
FT  152 - 159: similarity to beta-globin enhancer [1]
FT  156 - 162: putative binding site for Ubx [1]
FT  163 - 170: similarity to beta-globin enhancer [1]
FT  167 - 179: putative binding sites for Ubx [1]
FT  169 - 179: similarity to ARS of S. cerevisiae [1]
FT  192 - 197: putative GATA-1 binding site [1]
FT  203 - 208: putative GATA-1 binding site [1]
FT  207 - 211: putative binding site for Ubx and GAGA factor
FT               [1]
FT  212 - 221: similarity to SV40 ORI [1]
FT  215 - 239: putative binding sites for Ubx and GAGA factor
FT               [1]
FT  251 - 286: kinked DNA [1]
FT  258 - 264: similarty to CAT box [1]
FT  277 - 282: putative binding site for GAGA factor [1]
FT  287 - 293: putative binding site for Ubx [1]
FT  306 - 312: similar motif found in murine kappa MAR
FT               SM0000001 [1]
FT  324 - 357: curved DNA [1]
FT  331 - 358: kinked DNA [1]
FT  342 - 351: similarity to ARS of S. cerevisiae [1]
FT  345 - 351: putative binding site for Ubx [1]
FT  365 - 380: curved DNA [1]
FT  372 - 382: similarity to ARS of S. pombe [1]
FT  376 - 382: similar motif found in murine kappa MAR
FT               SM0000001 [1]
XX
SF  note: sequence given in [1] differs in a few positions
SF  from those available from EMBL; several GA-rich and TC-rich
SF  stretches [1]
XX
CP  K562 erythroleukemia cells [1]
XX
EV  in vivo selection/high salt [2]
XX
BF  SB000029; p53mut [2]
MM  liquid phase binding assay; 
SO  rec(mouse-); mouse
QA  6
XX
DR  EMBL: M32721; HSPPOL
DR  EMBL: M18112; HSPOLP
DR  EMBL: J03473; HSRISDAD
XX
RN  [1]
RA  Boulikas, T., Kong, C. F., Brooks, D., Hsie, L.
RT  The 3' untranslated region of the human
RT  poly(ADP-ribose)polymerase gene is a nuclear matrix
RT  anchoring site
RL  Int. J. Oncol. 9:1287-1294 (1996)
RN  [2]
RX  MEDLINE; 98241021 PubMed; 9581865
RA  Will, K., Warnecke, G., Albrechtsen, N., Boulikas, T.,
RA  Deppert, W.
RT  High affinity MAR-DNA binding is a common property of
RT  murine and human mutant p53
RL  J. Cell. Biochem. 69:260-270 (1998)
//