S/MARt DB - S/MAR

AC  SM0000118
XX
DT  2.2.1999 14:46:01 (created); ili
XX
NA  DROME$SatIII
XX
SY  1.688 repeat satellite, 359 bp repeat satellite, 
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  359 bp
XX
LO  X, centromeric
XX
SQ  CCACATTTTGCAAATTTTGATGACCCCCCTCCTTACAAAAAATGCGAAAATTGATCCAAA
SQ  AATTAATTTCCCTAAATCCTTCAAAAAGTAATAGGGATCGTTAGCACTGGTAATTAGCTG
SQ  CTCAAAACAGATATTCGTACATCTATGTGACCATTTTTAGCCAAGTTATAACGAAAATTT
SQ  CGTTTGTAAATATCCACTTTTTTGCAGAGTCTGTTTTTCCAAATTTCGGTCATCAAATAA
SQ  TCATTTATTTTGCCACAACATAAAAAATAATTGTCTGAATATGGAATGTCATATCTCACT
SQ  GAGCTCGTAATAAAATTTCCAATCAAACTGTGTTCAAAAATGGAAATTAAATTTTTTGG
SC  EMBL #J01126
XX
FT  19 - 36(EMBL): Drosophila topoisomerase II site [1]
XX
EV  in vivo selection of S/MAR [1]
XX
BF  SB000022; topoisomerase II [1]
MM  topoisomerase II cleavage assay; 
SO  Kc; Drosophila
QA  6
BF  SB000034; MATH20 [2]
MM  topoisomerase II cleavage assay; 
SO  rec; 
QA  6
XX
DR  EMBL: J01126; DMJSATB
XX
RN  [1]
RX  MEDLINE; 92164660 PubMed; 1311255
RA  Kaes, E., Laemmli, U. K.
RT  In vivo topoisomerase II cleavage of the Drosophila histone
RT  and satellite III repeats: DNA sequence and structural
RT  characteristics
RL  EMBO J. 11:705-716 (1992)
RN  [2]
RX  MEDLINE; 98190088 PubMed; 9524129
RA  Girard, F., Bello, B., Laemmli, U. K., Gehring, W. J.
RT  In vivo analysis of scaffold-associated regions in
RT  Drosophila: a synthetic high-affinity SAR binding protein
RT  suppresses position effect variegation
RL  EMBO J. 17:2079-2085 (1998)
//