S/MARt DB - S/MAR

AC  SM0000119
XX
DT  3.2.1999 12:00:14 (created); ili
XX
NA  HS$HPRT-3MAR2
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  832 bp
XX
LO  X
DE  G000304; hypoxanthine-guanine phosphribosyltransferase
DP  Direction: 3'; 16431 - 17262; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  maps to the third intron [1]
XX
SQ  GATTGTGCAGAATGTTATTTTAGATAAGCAAAAACGAGCAAAATAGGGGAGTTTAACTTT
SQ  AATATTTTCTTTTAAAAAGCATTTCATGTTATAAGATCAATTCTGAGTGGTAGAAAATGC
SQ  TTTGACATTTTATTTCCATTTTCTACTTTTAGTTTTTTTCCTATTTGTTTAAGATCTTAG
SQ  AGGATTATTAAGCTGAACTCCTCAACTGATAAAAAGCATGACATCTTAAACATAAGCAAA
SQ  GCATATTTTTAGGTTAATTTTCACATAGAAAACAGTTTATTTTATGTGAAATTCTATGTA
SQ  GATATACTATTTTTTTGGTATTTATTGATATGTTTATTTTATTTTATTTTATTTTATTTT
SQ  ATTTTATTTTATTTTATTTATTTATTTTTTTTTTTGAGACAGAGTCTCACTCTGTTGCCC
SQ  AGGCTGGAGTGCAGTGGCATGATCGTAGCTCACTGCAACCTCCACTCCCGGGTTCAAGCA
SQ  ATTCTTCTGTCTCAGCCTCCCGAGTAGCTGGGACTACAGGTGCCTGCCACTATGCCCGGC
SQ  TAATTTTTGTGTTTTTAGTAGAGATGGGGTTTCACCTTGTTGGTCAGGCTGGTCTCGAAC
SQ  CCCTGACCTCAGGTGATCCACCCACCTCAGCCTCCCAAAGTGCTGGGATTATAGGCATGA
SQ  GCCACGTGCCCGGCCGACATGTTAATTTTTTAAAAAAGGCTTTACTGGGGTATATTTTAT
SQ  ATAATATAATAATCACATGTTTTAACTATACAATTCCAAGCTTTTTAGTATATTTATAGG
SQ  GCTATGCAAGGAAGATATACTGTTAAACAGTAGAAATTGAGAAAGCTCTTCT
SC  EMBL #M26434; nt 18108-18939
XX
FT  18108 - 18509(EMBL): strongly attached region, bending [1]
FT  18424 - 18491(EMBL): footprint 1 [1]
FT  18439 - 18783(EMBL): Alu repeat [1]
FT  18775 - 18805(EMBL): footprint 2 [1]
FT  18784 - 18939(EMBL): weakly attached region [1]
FT  18816 - 18857(EMBL): footprint 3 [1]
XX
SF  footprint 2 covers a (Hpa II) site that is differnetially
SF  methylated [1]; sites for topoisomerase II from chicken
SF  and Drosophila [1]; motifs matching the yeast ARS
SF  consensus [1]
XX
FF  may be involved in controlling X-linked Hrpt expression
FF  [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from rat liver, also used subfragments [1]
XX
DR  EMBL: M26434; HSHPRT8A
XX
RN  [1]
RX  MEDLINE; 96038826 PubMed; 7578242
RA  Chong, S., Taylor, K. A., Piper, A. A.
RT  Intragenic matrix attachment and DNA-protein interactions
RT  in thehuman X-linked Hprt gene
RL  Biochim. Biophys. Acta 1264:103-114 (1995)
//