S/MARt DB - S/MAR

AC  SM0000120
XX
DT  5.2.1999 11:03:23 (created); ili
DT  12.2.2002 16:03:00 (updated); ili
XX
NA  Y$ARS1
XX
OS  yeast, Saccharomyces cerevisiae
OC  Eukaryota; Fungi; Ascomycota; Hemiascomycetes;
OC  Saccharomycetales; Saccharomycetaceae; Saccharomyces.
XX
SZ  842 bp
XX
DE  G000993; N-(5'-phosphoribosyl)anthranilate isomerase
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
XX
SQ  AGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGA
SQ  TTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGAC
SQ  TCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTAT
SQ  TTATTTAAGTATTGTTTGTGCACTTGCCTGCAGGCCTTTTGAAAAGCAAGCATAAAAGAT
SQ  CTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGCTTTT
SQ  TGATTGATTGTACAGGAAAATATACATCGCAGGGGGTTGACTTTTACCATTTCACCGCAA
SQ  TGGAATCAAACTTGTTGAAGAGAATGTTCACAGGCGCATACGCTACAATGACCCGATTCT
SQ  TGCTAGCCTTTTCTCGGTCTTGCAAACAACCGCCGGCAGCTTAGTATATAAATACACATG
SQ  TACATACCTCTCTCCGTATCCTCGTAATCATTTTCTTGTATTTATCGTCTTTTCGCTGTA
SQ  AAAACTTTATCACACTTATCTCAAATACACTTATTAACCGCTTTTACTATTATCTTCTAC
SQ  GCTGACAGTAATATCAAACAGTGACACATATTAAACACAGTGGTTTCTTTGCATAAACAC
SQ  CATCAGCCTCAAGTCGTCAAGTAAAGATTTCGTGTTCATGCAGATAGATAACAATCTATA
SQ  TGTTGATAATTAGCGTTGCCTCATCAATGCGAGATCCGTTTAACCGGACCCTAGTGCACT
SQ  TACCCCACGTTCGGTCCACTGTGTGCCGAACATGCTCCTTCACTATTTTAACATGTGGAA
SQ  TT
SC  EMBL #V01341; nt 616-1457
XX
FT  616 - 774(EMBL): 3' end of TRP 1 coding region [1]
FT  717 - 780(EMBL): bent DNA [1]
FT  753 - 770(EMBL): site for ARS binding factor 1 [1]
FT  857 - 867(EMBL): ARS consensus sequence [1] [5]
XX
SF  several A and T boxes, 2 ATC tracts [5]
XX
BP  26-32% [4]
XX
FF  supports autonomous replication in yeast, but not supposed
FF  to do so in plants [3]; weak binding activity in
FF  comparison with other S/MARs [5]; augments gene
FF  expression in tobacco and rice [3] [7]; found to
FF  have a negative effect on transgene expression in the
FF  context of a heterologous fusion gene [8]; does not
FF  decrease intertransformant variability [3]; does not
FF  protect against trans-silencing in plants [6]; does not
FF  exhibit protective properties in the context of a
FF  heterologous fusion gene [8]; limited effect on
FF  stabilization of transgene expression level between
FF  generations [7]; may be involved in transcription
FF  termination [1]
XX
EV  in vitro selection of S/MAR [5]
XX
BF  SB000046; ACBP [2]
MM  direct gel shift; 
PR  single stranded probes: Hind III/Rsa I, Hind III/Bgl II,
PR  Hind III/Pst I
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
XX
DR  EMBL: V01341; SCTRP1
DR  EMBL: M30386; YSTRS1
XX
RN  [1]
RX  MEDLINE; 87065038 PubMed; 3785376
RA  Snyder, M., Buchman, A. R., Davis, R. W.
RT  Bent DNA at a yeast autonomously replicating sequence
RL  Nature 324:87-89 (1986)
RN  [2]
RX  MEDLINE; 91160059 PubMed; 2001590
RA  Hofmann, J. F., Gasser, S. M.
RT  Identification and purification of a protein that binds the
RT  yeast ARS consensus sequence
RL  Cell 64:951-960 (1991)
RN  [3]
RX  MEDLINE; 93320655 PubMed; 8329896
RA  Allen, G. C., Hall jr, G. E., Childs, L. C., Weissinger, A.
RA  K., Spiker, S., Thompson, W. F.
RT  Scaffold attachment regions increase reporter gene
RT  expression in stably transformed plant cells
RL  Plant Cell 5:603-613 (1993)
RN  [4]
RX  MEDLINE; 95250413 PubMed; 7537426
RA  Rzeszowska-Wolny, J., Rogolinski, J.
RT  MspI8, the repetitive sequence specifically interacting
RT  with nuclear matrix of rat testis cells
RL  Acta Biochim. Pol. 41:459-466 (1994)
RN  [5]
RX  MEDLINE; 96240023 PubMed; 8672887
RA  Allen, G. C., Hall jr, G. E., Michalowski, S., Newman, W.,
RA  Spiker, S., Weissinger, A. K., Thompson, W. F.
RT  High-level transgene expression in plant cells:effects of a
RT  strong scaffold attachment region from tobacco
RL  Plant Cell 8:899-913 (1996)
RN  [6]
RX  MEDLINE; 99005255 PubMed; 9790594
RA  Vaucheret, H., Elmayan, T., Thierry, D., van der Geest, A.,
RA  Hall, T., Conner, A. J., Mlynarova, L., Nap, J. P.
RT  Flank matrix attachment regions (MARs) from chicken, bean,
RT  yeast or tobacco do not prevent homology-dependent
RT  trans-silencing in transgenic tobacco plants
RL  Mol. Gen. Genet. 259:388-392 (1998)
RN  [7]
RA  Vain, P., Worland, B., Kohli,  A., Snape, J. W., Christou,
RA  P., Allen, G. C., Thompson, W. F.
RT  Matrix attachment regions increase transgene expression
RT  levels and stability in transgenic rice plants and their
RT  progeny
RL  Plant J. 18:233-242 (1999)
RN  [8]
RX  MEDLINE; 21669042 PubMed; 11810265
RA  Holmes-Davis, R., Comai, L.
RT  The matrix attachment regions (MARs) associated with the
RT  heat shock cognate 80 gene ( HSC80) of tomato represent
RT  specific regulatory elements
RL  Mol. Genet. Genomics 266:891-898 (2002)
//