S/MARt DB - S/MAR

AC  SM0000134
XX
DT  8.3.1999 16:28:27 (created); ili
DT  23.3.2004 11:01:00 (updated); ili2
XX
NA  RAT$MAR1
XX
OS  rat, Rattus spec.
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  370 bp
XX
SQ  TTTTCCTATATCCCGAACAGTCCACTTATTACTAGTGCGGCCTATTGGGAACTAACCGAA
SQ  TTCACCATGTTACTCAGTTTCGGCTCACCAAATTTTTATAAATCTTTAAAAGTACACATA
SQ  TTACAAGAGCAGGCTACTAGGAACTAACTGAATTCACAAAGAAACAGTGTTTCAGTGCGT
SQ  TAAAACGTTGCTCTATCTTGAATAACAAGCTTATTACATGCGAATCCTATTGGGAACCTA
SQ  CTCAATTCAACATGATACTTAGATTCCCTTCCTTAAAATGTTGCTCGATATTGAAAAGCA
SQ  AACTCATGCAAGCATGTCCCATTGGGAACTCACTGAATTCGCCTAGAAAATTTGATTCCG
SQ  TTCGTGAAAA
SC  [4]
XX
FT  88 - 124: p130 binding [2]
FT  107 - 207: required for augmentation of transcription
FT               [6]
FT  125 - 167: distamycin A binding [2]
FT  130 - 172: p130 binding [2]
FT  187 - 0: bending center [6]
XX
SF  bent DNA [4]; suggested to be hypermethylated [5];
SF  introduction of additional methylated cytosines does not
SF  affect bending [5]
XX
FF  highly repetitive DNA component [4] [1]; augments
FF  SV40 promoter-mediated luciferase gene transcription
FF  [6]; becomes inert to augmentation of transcription
FF  when methylated [6]
XX
CP  rat liver [4]
XX
BF  SB000040; p230 [4]
MM  southwestern blotting; 
SO  AH414; rat
QA  6
BF  SB000041; p130 [2]
MM  DNase I footprinting; 
SO  rl; rat
QA  6
BF  SB000041; p130 [4]
MM  southwestern blotting; 
SO  rl; rat
QA  6
BF  SB000041; p130 [3]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
BF  SB000042; p123 [4]
MM  southwestern blotting; 
SO  rl; rat
QA  6
BF  SB000042; p123 [3]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
BF  SB000082; p83 [5]
MM  southwestern blotting; 
SO  Ac2F; rat
QA  6
XX
RN  [1]
RX  MEDLINE; 92246976 PubMed; 1575753
RA  Hibino, Y., Nakamura, K., Asano, S., Sugano, N.
RT  Affinity of a highly repetitive bent DNA for nuclear
RT  scaffold proteins from rat liver.
RL  Biochem. Biophys. Res. Commun. 184:853-858 (1992)
RN  [2]
RX  MEDLINE; 94071964 PubMed; 8250943
RA  Hibino, Y., Tsukada, S., Sugano, N.
RT  Properties of a DNA-binding protein from rat nuclear
RT  scaffold fraction
RL  Biochem. Biophys. Res. Commun. 197:336-342 (1993)
RN  [3]
RX  MEDLINE; 93363634 PubMed; 8357833
RA  Hibino, Y., Nakamura, K., Sugano, N.
RT  Purification and characterization of nuclear scaffold
RT  proteins which bind to a highly repetitive bent DNA from
RT  rat liver.
RL  Biochim. Biophys. Acta 1174:162-170 (1993)
RN  [4]
RX  MEDLINE; 97265267 PubMed; 9111204
RA  Hibino, Y., Tsukada, S., Sugano, N.
RT  Purification and characterization of a DNA binding protein
RT  in a nuclear scaffold fraction from rat ascites hepatoma
RT  cells
RL  Carcinogenesis 18:707-713 (1997)
RN  [5]
RX  MEDLINE; 99045399 PubMed; 9826523
RA  Hibino, Y., Ohzeki, H., Hirose, N., Morita, Y., Sugano, N.
RT  Involvement of DNA methylation in binding of a highly
RT  repetitive DNA component to nuclear scaffold proteins from
RT  rat liver
RL  Biochem. Biophys. Res. Commun. 252:296-301 (1998)
RN  [6]
RX  MEDLINE; 20563837 PubMed; 11112453
RA  Hibino, Y., Ohzeki, H., Sugano, N., Hiraga, K.
RT  Transcription modulation by a rat nuclear scaffold protein,
RT  P130, and a rat highly repetitive DNA component or various
RT  types of animal and plant matrix or scaffold attachment
RT  regions
RL  Biochem. Biophys. Res. Commun. 279:282-287 (2000)
//