S/MARt DB - S/MAR

AC  SM0000135
XX
DT  8.3.1999 16:31:17 (created); ili
DT  19.2.2002 17:42:00 (updated); ili
XX
NA  RAT$MAR2
XX
OS  rat, Rattus spec.
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  369 bp
XX
SQ  TTTTCTATATCCCGAACAGTCCACTTATTACTACTGTGGCCTATTGGGAACTAACCGAAT
SQ  TCACCATGTTACTCAGATTCGGCTAAACAAACTTTTAAAAATCTCTAAAAGTACACATAT
SQ  TACAAGAGCAGGCTACTAGGAACTAACTGAATTCACAAAGATACAGTGTTTCAGTTCGTT
SQ  AAAACGTTGCTCTATCTTGAATAACAAGCTTATTACATGCGAATCCTATTGGGAACCTAC
SQ  TCAATTCGCAATGATACTTGGATTCCGTTCCTTAAAATGTTGCTCAATATTGAAAGGCAA
SQ  ACTCATACAAGCATGTCCCATTGGGAACTCACTGAATTCGCCTAGAAATTTTGCTTCCAT
SQ  TCGTGAAAA
SC  [1]
XX
SF  bent DNA [1]; highly homologous to SM000134 [1]
XX
FF  highly repetitive DNA component [1]
XX
CP  hepatoma [1]
XX
BF  SB000040; p230 [1]
MM  nitrocellulose filter binding; 
SO  AH414; rat
QA  6
BF  SB000040; p230 [1]
MM  southwestern blotting; 
SO  AH414; rat
QA  6
BF  SB000040; p230 [1]
MM  replacement by distamycin A; 
SO  AH414; rat
QA  6
BF  SB000041; p130 [1]
MM  nitrocellulose filter binding; 
SO  rl; rat
QA  6
BF  SB000041; p130 [1]
MM  replacement by distamycin A; 
SO  rl; rat
QA  6
XX
RN  [1]
RX  MEDLINE; 97265267 PubMed; 9111204
RA  Hibino, Y., Tsukada, S., Sugano, N.
RT  Purification and characterization of a DNA binding protein
RT  in a nuclear scaffold fraction from rat ascites hepatoma
RT  cells
RL  Carcinogenesis 18:707-713 (1997)
//