S/MARt DB - S/MAR

AC  SM0000136
XX
DT  16.4.1999 18:08:21 (created); ili
DT  9.1.2002 11:33:00 (updated); dbo
XX
NA  MOUSE$IgH-5MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  573 bp
XX
DE  G000537; immunoglobulin heavy chain
DP  Direction: 5'; 574 - 1; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G000537;
immunoglobulin heavy chain

XX
SQ  TCCACATGTATGATTTTAATGTCAGATAAAGAATATTTCCAAGAATTATCCCCAAAATAT
SQ  AAGTATAAATATGTGCAAAACTTGTTTATTAACTTATTTATCTTAAAATCTGGTGCTTCA
SQ  TGTTTAAATCCAATCTATTGTCTGAAAGACATCCTGGCAGTTTAATATCCAGTAAATCTT
SQ  TCATGTACCTACAAAAAATAAAAAAATAAAGAATTTCCTACATGAGTACACCCTCCCCAA
SQ  ACACAAATAAATGAGTAATTTAGTGAAAAATTAGAAAAAAAAAGAAAAGAAATGTCAATA
SQ  CCAGTGAAGACATGAAGAATAGGTAGTCTTAGATATTGTTAGTTGGAAGGTGAACTTGTT
SQ  AAATCACAATAAAATATTGAAGTGTTATCACATACACATACTAAACAATTTTCTAACATT
SQ  GTTACTGATAGCTGATTCATTCACTATATCCCTGCATTTTGTAATAATAACTTCACTCTC
SQ  TACAACTTCAATCCTAGAGCTAATGATATAGCAGAAAGACATGCAAATTAGGCCACCCTC
SQ  ATCACATGAAAACCAGCCCAGAGTGACTCTAGC
SC  EMBL #J00519; nt 1-574
XX
FT  1 - 150(EMBL): matrix binding, "Bf150 fragment" [1]
FT  324 - 449(EMBL): Bright SB000044 binding [2]; "Tx125
FT                   fragment" [1]
XX
SF  contains overlapping sites for NF-muNR/Cux/CDP and Bright
SF  [3]
XX
FF  contains IL-5+Ag-inducible elements and entire promoter
FF  [1]; soluble proteins in nuclear extracts block binding
FF  to the nuclear matrix [1]; strong [1]
XX
EV  in vitro selection of S/MAR [1]
EC  matrix from EL-4 cells
XX
BF  SB000044; Bright [2]
MM  direct gel shift; 
PR  Tx125 fragment
SO  rec(S.pombe-ret lys); fission yeast, Schizosaccharomyces pombe
QA  6
BF  SB000044; Bright [2]
MM  supershift (antibody binding); 
PR  Tx125 fragment
SO  rec(S.pombe-ret lys); fission yeast, Schizosaccharomyces pombe
QA  6
BF  SB000044; Bright [2]
MM  gel shift competition; 
PR  Tx125 fragment
SO  rec(S.pombe-ret lys); fission yeast, Schizosaccharomyces pombe
QA  6
BF  SB000044; Bright [2]
MM  replacement by distamycin A; 
PR  Tx125 fragment
SO  rec(S.pombe-ret lys); fission yeast, Schizosaccharomyces pombe
QA  6
XX
DR  EMBL: J00519; MMIGHAE
XX
RN  [1]
RX  MEDLINE; 92017796 PubMed; 1922040
RA  Webb, C. F., Das, C., Eneff, K. L., Tucker, P. W.
RT  Identification of a matrix-associated region 5' of an
RT  immunoglobulin heavy chain variable region gene
RL  Mol. Cell. Biol. 11:5206-5211 (1991)
RN  [2]
RX  MEDLINE; 96127903 PubMed; 8543152
RA  Herrscher, R. F., Kaplan, M. H., Lelsz, D. L., Das, C.,
RA  Scheuermann, R. H., Tucker, P. W.
RT  The immunoglobulin heavy-chain matrix-assocating regions
RT  are bound by Bright: a B cell-specific trans-activator that
RT  describes a new DNA-binding protein family
RL  Genes Dev. 9:3067-3082 (1995)
RN  [3]
RX  MEDLINE; 99077966 PubMed; 9858552
RA  Wang, Z., Goldstein, A., Zong, R. T., Lin, D., Neufeld, E.
RA  J., Scheuermann, R. H., Tucker, P. W.
RT  Cux/CDP homeoprotein is a component of NF-muNR and
RT  represses the immunoglobulin heavy chain intronic enhancer
RT  by antagonizing the bright  transcription activator
RL  Mol. Cell. Biol. 19:284-295 (1999)
//