S/MARt DB - S/MAR

AC  SM0000137
XX
DT  22.4.1999 16:25:42 (created); ili
DT  28.5.2002 11:38:00 (updated); ili
XX
NA  HS$GLOBB-3MAR1
XX
SY  beta-IVS2 SAR, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  850 bp
XX
LO  11p15.5
DE  G000215; beta-globin
DP  Direction: 3'; 494 - 1344; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
DC  5' end of the second intron (beta IVS2) [1]
XX
SQ  GTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGT
SQ  CATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCA
SQ  TCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTT
SQ  TTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACT
SQ  TAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTA
SQ  AAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT
SQ  TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTA
SQ  TACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAG
SQ  GGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTT
SQ  ATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTAT
SQ  CATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGC
SQ  AATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATA
SQ  TTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG
SQ  CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTT
SQ  CCTCCCACAG
SC  EMBL #U01317; nt 62632-63481 (second intron of beta-globin gene)
XX
SF  A/T rich [1]; minimal attached region =  520 bp [1];
SF  contains motifs for transcription factors, e.g. GATA-1 and
SF  Oct-1 [3]; several footprints could be localized to
SF  this region 2 of which might be caused by SATB1 binding
SF  [3]
XX
FF  strong [1]; required for propper gene expression
FF  [3]; concluded not to be attached when using the high
FF  salt method for matrix preparation [2]; no binding of
FF  hnRNP-U SB000017 or p300 SB000089 in cells transfromed
FF  with adenovirus or SV40 [6]
XX
CP  K562 cells [1]; HeLa [4]
CN  sperm [4]
XX
EV  in vivo selection of S/MAR [5]
EV  in vivo selection/LIS [1]
XX
BF  SB000017; hnRNP-U [6]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
BF  SB000089; p300 [6]
MM  chromatin immunoprecipitation (ChIP); 
SO  U2-OS; human
QA  6
XX
DR  EMBL: U01317; HSHBB
XX
RN  [1]
RX  MEDLINE; 89091073 PubMed; 3208739
RA  Jarman, A. P., Higgs, D.R.
RT  Nuclear scaffold attachment sites in the human globin gene
RT  complexes
RL  EMBO J. 7:3337-3344 (1988)
RN  [2]
RX  MEDLINE; 93062867 PubMed; 1435759
RA  Bartjeliotou, A. J., Dimitriadis, G. J.
RT  The association of the human epsilon-globin gene with the
RT  nucleart matrix: a reconsideration
RL  Mol. Cell. Biochem. 115:105-115 (1992)
RN  [3]
RX  MEDLINE; 96081893 PubMed; 7499351
RA  Jackson, C. E., O'Neill, D., Bank, A.
RT  Nuclear factor binding sites in human beta globin IVS2.
RL  J. Biol. Chem. 270:28448-28456 (1995)
RN  [4]
RX  MEDLINE; 96216068 PubMed; 8662749
RA  Kramer, J. A., Krawetz, S. A.
RT  Nuclear matrix interactions within the sperm genome
RL  J. Biol. Chem. 271:11619-11622 (1996)
RN  [5]
RX  MEDLINE; 97293970 PubMed; 9149855
RA  Kramer, J. A., Krawetz, S. A.
RT  PCR-based assay to determine nuclear matrix association
RL  BioTechniques 22:826-828 (1997)
RN  [6]
RX  MEDLINE; 21907223 PubMed; 11909954
RA  Martens, J. H. A., Verlaan, M., Kalkhoven, E., Dorsman, J.
RA  C., Zantema, A.
RT  Scaffold/matrix attachment region elements interact with a
RT  p300-scaffold attachment factor A complex and are bound by
RT  acetylated nucleosomes
RL  Mol. Cell. Biol. 22:2598-2606 (2002)
//