S/MARt DB - S/MAR

AC  SM0000139
XX
DT  23.4.1999 13:46:09 (created); ili
DT  21.2.2000 14:45:58 (updated); ili
XX
NA  HS$GLOBB-3MAR3
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  3750 bp
XX
LO  11p15.5
DE  G000215; beta-globin
DP  Direction: 3'; 20000 - ; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DC  this entry refers to the most distal S/MAR 3' to the
DC  beta-globin gene shown in [1]

G000215;
beta-globin

XX
SQ  TCTAGAGAATTCTAAAAATCCACAGATTTAGAAATTCTAGGAATCCAAGAAATTACAATT
SQ  TTAGATCTACTACAATTTCACAATATAACAATAACCAATAAACACGGACATTTTATTTAC
SQ  ATAAATAAAAGATGGGTTTGTCACACAATTTAAAAATCTAGGGTCGAAAGCCACAGCAAA
SQ  GGCAACCTCCTGGCACTATATCACAATAGATGACACCTGCATAGAGAAAGCAAAGTGGTC
SQ  ATGTTAGTCACTGATTGCCTCAAATAACCCTGTGGGGATGTCTACTCTTTTGTATTCCAT
SQ  CAGCTTTTTTCCCAGTAACAACACATCCTAGCAATAATATCCTGACGAGTTTCTATAAAA
SQ  AAAAAAAACTCCCCTCCTAAGATACAGTATCTTTGTGGTTGCATCCCCAGCCATCCCTCA
SQ  TTTGGTTGAGGTTGGAATTTCAATGGGTGGGTTGAATTTTTCCCTAAACAAACTTGCCAT
SQ  GGTAAAATCAAGGCTAGCATTACTGTTCACACAAGGCACTGTGCTAAGATCCCCATCCTT
SQ  ATAGCAATGGGAGGGCTCATAGGCAAGTCATGTCATGCAGAGGCCATTTCATCATCCCTT
SQ  CTTGTCTTTGGGGACTTGGGTCTCTCCGGTTGTATAGGAGATTTCGCCAGGCATTTGAAT
SQ  CCTTCACTGCTAGTCATCCTGGACTCTGTGGTGTACAATATCCATCTCTCCTATGTTCTG
SQ  AGGTCAGAATGACCTCTCTCTTAACCAGTTGTCTGGGCCCAGGCTCCATTATTGATATAG
SQ  TCATGATCTCCTCTGTTGGGGATGAAGTAGGCAAATTTGAGGCACTAATTTACTTCTCAC
SQ  ATTCTTTTCTTGAACAGAAAGATAGAACTGGAAATTAATACTAGTATATAAATTCAAAAT
SQ  TTTAGTTTTAATAACATTTAATCAGACATAAATAATTATGGTAATGTGAATTTCAATAAA
SQ  TAAATTTTAGTTCTAATATAAGTGTAACTGTGTAATATTCATACTTTTTCTGAAGGCTTT
SQ  ACTAATTTGATATGGCATTACTTTTTATTGCTGCCAAAACTATTCTTATTCCACTGTGTG
SQ  GTGATGAGAAAGTGAGAGATGTTCTGGAGATGGTGATTATAGATAGCTTCCCTGAAGCCA
SQ  TAGTAACCCCCTGGAGAAAAATTGGACCTGGAGTCTAGCAGCCTAGGTATGGGTACTCGA
SQ  TTTCTTAGAAAGCCTTTACAATTTCCTTTATCTTAAAAATAAGGGTATTGAAGTAGAATT
SQ  CTAGAATTTTCAGAGGACAACTTAAAATATGTGTAATAGTTTTAATTATTTATCCTCATA
SQ  AATTTAACTGTTCATTTTAATATATTTAAGGATGAATTTTTTAAAAGTTGATTTCATAAA
SQ  AATGGGAATAGAAAGATGGTTCCATAGGCTGACTGAGAGTGTAGAGGAGGGATGGGAAGG
SQ  GAAAGAAGTTGATCTTCAGTTAGACTAGAGGAATAAGTTTTAGTGATCTCTCACACTGCA
SQ  TAGTGAACACAGTTAATAATATATTATGTATTTAAATTAAAAATTGCTAAAAAATAAATA
SQ  TTTTATGTTCTCACCACAAAAAAAGTTGGAAGGTGATTCATATGCTAATTAGCTTGATAG
SQ  ACTCTCTCTACAATGTATATATAGATCAAACATCACATTGTATCCCATAACATATTATAT
SQ  ATATTATATATTTATATTATATATTATTATTGTATCCATTAATATATCACTTATAATTTC
SQ  CAGGCAAATAAAAAATGTTTTTAAAATATAAATTTATTTGTAACCTCCTTTTACTTTTCT
SQ  GCTTGGTTTTCTTCTTTCATTCAGTGTTTACCAGTTTCTTATAGTTAATTTTATTTTAAG
SQ  CTGTCTCACATTTTCTGAAGAAAAGGGAACATATTAAAGCCAACAAAACAAATACACTAT
SQ  CTTGCATGAGATGATTTATGTCATGGTACAATCAAATGCTATAAATCTTATAAAAACTTC
SQ  TCAAATGGTTAGATGGCTACAGTTGAACAGATGGACCATGTCATATATTTTTTATAATGC
SQ  TTCTAAGGTATGGCTAATTTTTAAAAAATATTTTAGTAATGATGGGAATATTATTTATAG
SQ  AAATCTTATAAAATATATAATGAAATATGTAATAAAGTCTAGATAAATGTGTATATACAT
SQ  AATATATATTTATTACATAATATATAATATATAATGTATATTTATATATTACATGCATTA
SQ  TATATTAAATATAATACATTTTATATATTATATATTAAAATATGTAATATGTTATTAAAT
SQ  ATATACAATAATCTATTACATTTTATGCTTATATAATATATAATAAATATATAGTATATA
SQ  ATAAATATACACTATATATTTGTATCTATATATGTTTATAAAGTCATTCCTCTAATTAGG
SQ  TCATAACCAGTTCAGGTAAACTGGAAATTTAAGCCTACTTCAGGTTTGTGGTAAATAGAT
SQ  TCTCTCTGAACTAGCATATTCAGAATCATTAAACAGTCAGTTCTTTGGACAAGTCTTATA
SQ  GAATGTTCTTACCTCTTCAGCCATCCCAAGACTCTTGAGGGCCTGACCTCGCTTACACTA
SQ  AAGCAGATCTGCCTTATGCATCACTGAAGTAGGGAGGGAAGAAAGTTTGATGAACTACTT
SQ  CTGACCCCTAGTGGTGTCCAGAAAAGACCATTAAAGGAATGACCTTTAAAGGATGGACAT
SQ  ACAATTTTTTGTCCAAGGCAGGACATGTGTGGGTGTCTTTCAGTAATTATGTTCTAAGAA
SQ  CAGCAAAAACTCCACTGCCTTGGCAAATAGGAATGTTTTAGTTCTATAGAATTATAAAGA
SQ  AGCTGTCTTTTAAACACAATATACTTTCTCTATGTCTTTGGAACAATGACTATTGGTCAT
SQ  TACCCTATTTTAAAGTAAGCAAGTAATCACACAGGGAATTATTCTGAAAAGACAGAAAAA
SQ  AAAAAAAACCAAGAGATTTCTGCATATGTAGGTCAGTTTTAATCAGAGGGCATCAGAAAA
SQ  GACTCCTAAAAGAATGACCTGGTTATTATAATCACAGATTTGCGTTTCCAAGTCAACATT
SQ  CCAGACAGTGCTCAGAGGGGATACGAAAACCCTTTTATTTCTCCAGACTCAAATTCACTG
SQ  CTATTTGTCTTCTCTATTTATTTTATTATAGGCATTGTTCTGGTTGCTGGGAACTCAGAC
SQ  TGAGATACCATACACTGACTCTCAGATAGCATAAGACAACATGATGTCTTGGAAAACTGT
SQ  AAATCTTTTTGTTTTTTAAAATACAGGTGGAGCATCTGGCACACCTGACATATTGATCTT
SQ  GTTTTTCTTTAAATCTTCATTTATTTACCTTATCAAAACTATGCTCTTTCATCCTACCTT
SQ  TCAAAACATATTTTAAAAAATCCTCCAACATGTATTTTGCTCTGGTAATCCCAAAAGGCT
SQ  GATAGTCTCTATGGTGGCAACATGGATAATACTGTTCCCCATCTAGATGGTCTCATTTCT
SQ  TCTGTATCTAGTCTGAAGAAGCCTGAATGAAAGTAGATTTTTAAGCTTTGTAGCTAGTCT
SQ  GAAGCCTTTGTAGTCAGTCTGAAGAAACCTGCATGAAAATAGATTTTTTTTTTCCTTTGG
SQ  GACAGAGTCTTGCTCTGTCGCCCAGACTGGAGTGCAATGGCGCGATCTCGGCTCACTGCA
SQ  ACTTCCACCTCCCAGGATCAAGCAATTCTCCTGCCTCAGTCTCCCAAGTAACTGGGATTA
SQ  CAGGAGCACACTGCCATGCCCAGCTAATTA
SC  EMBL #X54282
XX
FT  264 - 281: vertebrate topoisomerase II consensus site
FT               (16/18) [2]
FT  1260 - 3750: matrix binding [2]
FT  1650 - 1650: DNase I hypersensitive site [2]
FT  1794 - 1811: vertebrate topoisomerase II consensus site
FT                 (16/18) [2]
FT  2570 - 2570: DNase I hypersensitive site [2]
FT  2670 - 2670: DNase I hypersensitive site [2]
XX
SF  sequence is incomplete at its 3' end as judged from [2];
SF  contains motifs for transcription factors GATA-1 and  AP-1
SF  [2]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: X54282; HSDNA11
XX
RN  [1]
RX  MEDLINE; 89091073 PubMed; 3208739
RA  Jarman, A. P., Higgs, D.R.
RT  Nuclear scaffold attachment sites in the human globin gene
RT  complexes
RL  EMBO J. 7:3337-3344 (1988)
RN  [2]
RX  MEDLINE; 93257703 PubMed; 8490185
RA  Fleenor, D. E., Kaufman, R. E.
RT  Characterization of the DNase I hypersensitive site 3' of
RT  the human beta globin gene domain
RL  Blood 81:2781-2790 (1993)
//