S/MARt DB - S/MAR

AC  SM0000142
XX
DT  23.4.1999 14:44:45 (created); ili
DT  1.3.2002 15:26:00 (updated); ili
XX
NA  HS$GLOBE-5MAR2
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2999 bp
XX
LO  11p15.5
DE  G000261; Agamma-globin
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 3
DE  G000253; epsilon-globin
DP  Direction: 5'; 21975 - 18975; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  refers to the distal S/MAR 5' to the epsilon-globin gene
DC  [1]
DE  G001095; Ggamma-globin
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 2

G000253;
epsilon-globin
G001095;
Ggamma-globin
G000261;
Agamma-globin

XX
SQ  AAGCTTCTGACAAATTATTCTTCCTCTTTAGGTTCTCCTTTATGGAATCTTCTGTACTGA
SQ  TGGCCATGTCCTTTAACTACTATGTAGATATCTGCTACTACCTGTATTATGCCTCTACCT
SQ  TTATTAGCAGAGTTATCTGTACTGTTGGCATGACAATCATTTGTTAATATGACTTGCCTT
SQ  TCCTTTTTCTGCTATTCTTGATCAAATGGCTCCTCTTTCTTGCTCCTCTCATTTCTCCTG
SQ  CCTTCACTTGGACGTGCTTCACGTAGTCTGTGCTTATGACTGGATTAAAAATTGATATGG
SQ  ACTTATCCTAATGTTGTTCGTCATAATATGGGTTTTATGGTCCATTATTATTTCCTATGC
SQ  ATTGATCTGGAGAAGGCTTCAATCCTTTTACTCTTTGTGGAAAATATCTGTAAACCTTCT
SQ  GGTTCACTCTGCTATAGCAATTTCAGTTTAGGCTAGTAAGCATGAGGATGCCTCCTTCTC
SQ  TGATTTTTCCCACAGTCTGTTGGTCACAGAATAACCTGAGTGATTACTGATGAAAGAGTG
SQ  AGAATGTTATTGATAGTCACAATGACAAAAAACAAACAACTACAGTCAAAATGTTTCTCT
SQ  TTTTATTAGTGGTTATATTTCCTGACCTATATCTGGCAGGACTCTTTAGAGAGGTAGCTG
SQ  AAGCTGCTGTTATGACCACTAGAGGGAAGAAGATACCTGTGGAGCTAATGGTCCAAGATG
SQ  GTGGAGCCCCAAGCAAGGAAGTTGTTAAGGAGCCCTTTTGATTGAAGGTGGGTGCCCCCA
SQ  CCTTACAGGGACAGGACATCTGGATACTCCTCCCAGTTTCTCCAGTTTCCCTTTTTCCTA
SQ  ATATATCTCCTGATAAAATGTCTATACTCACTTCCCCATTTCTAATAATAAAGCAAAGGC
SQ  TAGTTAGTAAGACATCACCTTGCATTTTGAAAATGCCATAGACTTTCAAAATTATTTCAT
SQ  ACATCGGTCTTTCTTTATTTCAAGAGTCCAGAAATGGCAACATTACCTTTGATTCAATGT
SQ  AATGGAAAGAGCTCTTTCAAGAGACAGAGAAAAGAATAATTTAATTTCTTTCCCCACACC
SQ  TCCTTCCCTGTCTCTTACCCTATCTTCCTTCCTTCTACCCTCCCCATTTCTCTCTCTCAT
SQ  TTCTCAGAAGTATATTTTGAAAGGATTCATAGCAGACAGCTAAGGCTGGTTTTTTCTAAG
SQ  TGAAGAAGTGATATTGAGAAGGTAGGGTTGCATGAGCCCTTTCAGTTTTTTAGTTTATAT
SQ  ACATCTGTATTGTTAGAATGTTTTATAATATAAATAAAATTATTTCTCAGTTATATACTA
SQ  GCTATGTAACCTGTGGATATTTCCTTAAGTATTACAAGCTATACTTAACTCACTTGGAAA
SQ  ACTCAAATAAATACCTGCTTCATAGTTATTAATAAGGATTAAGTGAGATAATGCCCTATA
SQ  AGATTCCTATTAATAACAGATAAATACATACACACACACACACATTGAAAGGATTCTTAC
SQ  TTTGTGCTAGGAACTATAATAAGTTCATTGATGCATTATATCATTAAGTTCTAATTTCAA
SQ  CACTAGAAGGCAGGTATTATCTAAATTTCATACTGGATACCTCCAAACTCATAAAGATAA
SQ  TTAAATTGCCTTTTGTCATATATTTATTCAAAAGGGTAACTCAAACTATGGCTTGTCTAA
SQ  TTTTATATATCACCCTACTGAACATGACCCTATTGTGATATTTTATAAAATTATCTCAAG
SQ  TTATTATGAGGATGTTGAAAGACAGAGAGGATGGGTGCTATGCCCCAAATCAGCCTCACA
SQ  ATTAAGCTAAGCAGCTAAGAGTCTTGCAGGGTAGTGTAGGGACCACAGGGTTAAGGGGGC
SQ  AGTAGAATTATACTCCCACTTTAGTTTCATTTCAAACAATCCATACACACACAGCCCTGA
SQ  GCACTTACAAATTATACTACGCTCTATACTTTTTGTTTAAATGTATAAATAAGTGGATGA
SQ  AAGAATAGATAGATAGACAGATAGATGATAGATAGAATAAATGCTTGCCTTCATAGCTGT
SQ  CTCCCTACCTTGTTCAAAATGTTCCTGTCCAGACCAAAGTACCTTGCCTTCACTTAAGTA
SQ  ATCAATTCCTAGGTTATATTCTGATGTCAAAGGAAGTCAAAAGATGTGAAAAACAATTTC
SQ  TGACCCACAACTCATGCTTTGTAGATGACTAGATCAAAAAATTTCAGCCATATCTTAACA
SQ  GTGAGTGAACAGGAAATCTCCTCTTTTCCCTACATCTGAGATCCCAGCTTCTAAGACCTT
SQ  CAATTCTCACTCTTGATGCAACAGACCTTGGAAGTATACAGGAGAGCTGAACTTGGTCAA
SQ  CAAAGGAGAAAAGTTTGTTGGCCTCCAAAGGCACAGCTCAAACTTTTCAAGCCTTCTCTA
SQ  ATCTTAAAGGTAAACAAGGGTCTCATTTCTTTGAGAACTTCAGGGAAAATAGACAAGGAC
SQ  TTGCCTGGTGCTTTTGGTAGGGGAGCTTGCACTTTCCCCCTTTCTGGAGGAAATATTTAT
SQ  CCCCAGGTAGTTCCCTTTTTGCACCAGTGGTTCTTTGAAGAGACTTCCACCTGGGAACAG
SQ  TTAAACAGCAACTACAGGGCCTTGAACTGCACACTTTCAGTCCGGTCCTCACAGTTGAAA
SQ  AGACCTAAGCTTGTGCCTGATTTAAGCCTTTTTGGTCATAAAACATTGAATTCTAATCTC
SQ  CCTCTCAACCCTACAGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTA
SQ  TCCCTCAAGCAGTGTCAGGAATTAGTCATTTAAATAGTCTGCAAGCCAGGAGTGGTGGCT
SQ  CATGTCTGTAATTCCAGCACTTGAGAGGTAGAAGTGGGAGGACTGCTTGAGCTCAAGAGT
SQ  TTGATATTATCCTGGACAACATAGCAAGACCTCGTCTCTACTTAAAAAAAAAAAATTAGC
SQ  CAGGCATGTGATGTACACCTGTAGTCCCAGCTACTCAGGAGGCCGAAATGGGAGGATCC
SC  EMBL #L22754
XX
FT  840 - 848(EMBL): MAR-like motif [2]
FT  1149 - 1157(EMBL): MAR-like motif [2]
FT  1252 - 1266(EMBL): similarity to the topoisomerase II
FT                     consensus site [2]
FT  1456 - 1470(EMBL): similarity to the topoisomerase II
FT                     consensus site [2]
FT  1636 - 1644(EMBL): MAR-like motif [2]
FT  2689 - 2999(EMBL): locus control region [2]
XX
FF  acts synergistically with a weak enhancer to stimulate
FF  reporter gene to consistent expression levels independent
FF  of the position of integration in transient assay [2]
XX
CP  K562 cells [1]
XX
EV  in vivo selection/LIS [1]
XX
RN  [1]
RX  MEDLINE; 89091073 PubMed; 3208739
RA  Jarman, A. P., Higgs, D.R.
RT  Nuclear scaffold attachment sites in the human globin gene
RT  complexes
RL  EMBO J. 7:3337-3344 (1988)
RN  [2]
RX  MEDLINE; 94156191 PubMed; 8112598
RA  Yu, J., Bock, J. H., Slightom, J. L., Villeponteau, B.
RT  A 5' beta-globin matrix attachment region and the polyoma
RT  enhancer together confer position-independent transcription
RL  Gene 139:139-145 (1994)
//