S/MARt DB - S/MAR

AC  SM0000144
XX
DT  23.4.1999 15:37:47 (created); ili
DT  1.3.2002 15:30:00 (updated); ili
XX
NA  MOUSE$GLOBB-5MAR
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  877 bp
XX
DE  G000484; betaM-globin
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G000484;
betaM-globin

XX
SQ  AGATCCCAAAAATTGAATAGAATCACTACTGCACAGGGTATGCTCAAGTTCAAATGTACC
SQ  TTATCTTTAAAACATTATTTAGCTATGTGTAAAAGTGAAATAAAGAGGTAAGTTCACATA
SQ  CAAATAGAGAGGCATACAAACATACATGCATACATACACATACATACATACATACATACA
SQ  TACATACACACAGACTCACAGACACACAGATATACAGAGATACAGACACACAGAGACACA
SQ  CACACAGGCACATATACAAATATACACACATAGACATATTCACAGATATACAGAGATACA
SQ  GACACACACTCAGAGACATACACATGGACATGCATACACACACACAGATATACACAGATA
SQ  CACACACACACATGGGCAGCATGTGCTGAGGACTTGGTTCAGTAAATAAAGGTCAAGGCT
SQ  GCCTGCCTTTAATTCAAAAGCGTGGAAGGACAGGACAATCCCTGAAAAAGCAGGTTATCC
SQ  AAGCTAACCAGATTTGTGAGCTCAGGGTTTACTTGAGAGATCCTGACTCAACAATAAGGT
SQ  ATAGAGCAATCAAGGGCGATTCTCTGAAGGCAGTTATTGAACTCCTTGTACACTCTTCCC
SQ  ACACACACGTGTTCAGAGAACTTGATAAAACACATATATACAAGTAAGCCACACAAACAT
SQ  TCACATGAGAGAAGAAAAACAAGAGCAAACTAAGTAAGATGCATTTTCTTATCAGGAAGT
SQ  TTAGTTGACACCAGAAAGAAGTCATATTTGGAATCAAAATGGAATCATCATCATGTATGC
SQ  TAAAGATGTTTTTTTCACATTCTTGAGCAATGTGGACAGAGAAGGAGATTCATCCATGCA
SQ  CTCAAACTGGGAAACAAAGAAAAGAAATCCTCTTCTA
SC  EMBL #J00413; nt 1449-2325
XX
FT  2189 - 2205(EMBL): site with similarity to the topoisomerase
FT                     II consensus of Drosophila [1]
XX
SF  caution: the size of the S/MAR-containing fragment was
SF  stated to be 780 bp in [1]
XX
TP  constitutive at least in somatic cells [1] [2]
XX
CP  MEL cells, induced MEL cells and NS-1cells [1]
CN  sperm [2]
XX
EV  in vivo selection/LIS [1]
XX
DR  EMBL: J00413; MMHBBMAJ
XX
RN  [1]
RX  MEDLINE; 89152747 PubMed; 3229284
RA  Greenstein, R. J.
RT  Constitutive attachment of murine erythroleukemia cell
RT  histone-depleted DNA loops to nuclear scaffolding is found
RT  in the beta-major but not the alpha1-globin gene
RL  DNA 7:601-607 (1988)
RN  [2]
RX  MEDLINE; 96216068 PubMed; 8662749
RA  Kramer, J. A., Krawetz, S. A.
RT  Nuclear matrix interactions within the sperm genome
RL  J. Biol. Chem. 271:11619-11622 (1996)
//