S/MARt DB - S/MAR

AC  SM0000150
XX
DT  28.4.1999 17:01:54 (created); ili
XX
NA  PV$Phs-5MAR
XX
OS  french bean, Phaseolus vulgaris
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; rosidae; fabales; fabaceae
XX
SZ  1053 bp
XX
DE  G000671; 
DP  Direction: 5'; 1471 - 424; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G000671;

XX
SQ  GAATTCATTGTACTCCCAGTATCATTATAGTGAAAGTTTTGGCTCTCTCGCCGGTGGTTT
SQ  TTTACCTCTATTTAAAGGGGTTTTCCACCTAAAAATTCTGGTATCATTCTCACTTTACTT
SQ  GTTACTTTAATTTCTCATAATCTTTGGTTGAAATTATCACGCTTCCGCACACGATATCCC
SQ  TACAAATTTATTATTTGTTAAACATTTTCAAACCGCATAAAATTTTATGAAGTCCCGTCT
SQ  ATCTTTAATGTAGTCTAACATTTTCATATTGAAATATATAATTTACTTAATTTTAGCGTT
SQ  GGTAGAAAGCATAAAGATTTATTCTTATTCTTCTTCATATAAATGTTTAATATACAATAT
SQ  AAACAAATTCTTTACCTTAAGAAGGATTTCCCATTTTATATTTTAAAAATATATTTATCA
SQ  AATATTTTTCAACCACGTAAATCTCATAATAATAAGTTGTTTCAAAAGTAATAAAATTTA
SQ  ACTCCATAATTTTTTTATTCGACTGATCTTAAAGCAACACCCAGTGACACAACTAGCCAT
SQ  TTTTTTCTTTGAATAAAAAAATCCAATTATCATTGTATTTTTTTTATACAATGAAAATTT
SQ  CACCAAACAATCATTTGTGGTATTTCTGAAGCAAGTCATGTTATGCAAAATTCTATAATT
SQ  CCCATTTGACACTACGGAAGTAACTGAAGATCTGCTTTTACATGCGAGACACATCTTCTA
SQ  AAGTAATTTTAATAATAGTTACTATATTCAAGATTTCATATATCAAATACTCAATATTAC
SQ  TTCTAAAAAATTAATTAGATATAATTAAAATATTACTTTTTTAATTTTAAGTTTAATTGT
SQ  TGAATTTGTGACTATTGATTTATTATTCTACTATGTTTAAATTGTTTTATAGATAGTTTA
SQ  AAGTAAATATAAGTAATGTAGTAGAGTGTTAGAGTGTTACCCTAAACCATAAACTATAAC
SQ  ATTTATGGTGGACTAATTTTCATATATTTCTTATTGCTTTTACCTTTTCTTGGTATGTAA
SQ  GTCCGTAACTAGAATTACAGTGGGTTGCCATGG
SC  EMBL #J01263; nt 1-1053
XX
FT  -1069 - -681(transcriptional start): core S/MAR [1]
FT  -682 - -628(transcriptional start): enhancer [1]
XX
SF  2 T-box motifs, 4 sites displaying similarity to Drosophila
SF  topoisomerase II consensus, AATATTTTT motif [1]; may
SF  contain BURs [1]
XX
BP  74-100% [1]
CH  insulator [1]
XX
FF  conferes positional independence [1]; causes positive
FF  correlation between copy number and expression of reporter
FF  gene [1]; does not protect against trans-silencing
FF  [2]
XX
EV  in vitro selection of S/MAR [1]
EC  tobacco matrices
XX
DR  EMBL: J01263; PVPHASL
XX
RN  [1]
RA  van der Geest, A. H. M., Hall jr, G. E., Spiker, S., Hall,
RA  T. C.
RT  The beta-phaseolin gene is flanked by matrix attachment
RT  regions
RL  Plant J. 6:413-423 (1994)
RN  [2]
RX  MEDLINE; 99005255 PubMed; 9790594
RA  Vaucheret, H., Elmayan, T., Thierry, D., van der Geest, A.,
RA  Hall, T., Conner, A. J., Mlynarova, L., Nap, J. P.
RT  Flank matrix attachment regions (MARs) from chicken, bean,
RT  yeast or tobacco do not prevent homology-dependent
RT  trans-silencing in transgenic tobacco plants
RL  Mol. Gen. Genet. 259:388-392 (1998)
//