S/MARt DB - S/MAR

AC  SM0000158
XX
DT  7.5.1999 11:23:31 (created); ili
DT  18.6.2002 13:08:00 (updated); ili
XX
NA  HPV$E5-MAR
XX
OS  HPV-16, human papilloma virus type 16
OC  viridae; ds-DNA nonenveloped viruses; papovaviridae;
OC  papillomavirus
XX
SZ  802 bp
XX
DE  G000171; human papilloma virus type 16 E6 promoter
DP  3536 - 4337; Pos 1: genome numbering
DC  coincides with the E5 gene and the early-late intergenic
DC  region [1]
XX
SQ  CAGTGGACAGTGCTCCAATCCTCACTGCATTTAACAGCTCACACAAAGGACGGATTAACT
SQ  GTAATAGTAACACTACACCCATAGTACATTTAAAAGGTGATGCTAATACTTTAAAATGTT
SQ  TAAGATATAGATTTAAAAAGCATTGTACATTGTATACTGCAGTGTCGTCTACATGGCATT
SQ  GGACAGGACATAATGTAAAACATAAAAGTGCAATTGTTACACTTACATATGATAGTGAAT
SQ  GGCAACGTGACCAATTTTTGTCTCAAGTTAAAATACCAAAAACTATTACAGTGTCTACTG
SQ  GATTTATGTCTATATGACAAATCTTGATACTGCATCCACAACATTACTGGCGTGCTTTTT
SQ  GCTTTGCTTTGTGTGCTTTTGTGTGTCTGCCTATTAATACGTCCGCTGCTTTTGTCTGTG
SQ  TCTACATACACATCATTAATAATATTGGTATTACTATTGTGGATAACAGCAGCCTCTGCG
SQ  TTTAGGTGTTTTATTGTATATATTATATTTGTTTATATACCATTATTTTTAATACATACA
SQ  CATGCACGCTTTTTAATTACATAATGTATATGTACATAATGTAATTGTTACATATAATTG
SQ  TTGTATACCATAACTTACTATTTTTTCTTTTTTATTTTCATATATAATTTTTTTTTTTGT
SQ  TTGTTTGTTTGTTTTTTAATAAACTGTTATTACTTAACAATGCGACACAAACGTTCTGCA
SQ  AAACGCACAAAACGTGCATCGGCTACCCAACTTTATAAAACATGCAAACAGGCAGGTACA
SQ  TGTCCACCTGACATTATACCTA
SC  EMBL #K02718; nt 3536-4337
XX
FT  3681 - 4108(EMBL): strongest S/MAR binding [1]
XX
BP  found to be the strongest S/MAR in HPV-16 [1]
XX
FF  acts in transient transfection as cis-responsive repressor
FF  on the E6 P97 enhancer-promoter [2]; weak
FF  cis-responsive activator in stable transfectants [2]
XX
CP  CaSki cervix carcinoma cells [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
EC  matrix from CaSki cells [1]
XX
DR  EMBL: K02718; PA16
XX
RN  [1]
RX  MEDLINE; 98216720 PubMed; 9557642
RA  Tan, S.-H., Bartsch, D., Schwarz, E., Bernard, H.-U.
RT  Nuclear matrix attachment regions of human papillomavirus
RT  type 16 point toward conservation of these genomic elements
RT  in all genital papillomaviruses
RL  J. Virol. 72:3610-3622 (1998)
RN  [2]
RX  MEDLINE; 20148940 PubMed; 10684263
RA  Stuenkel, W., Huang, Z., Tan, S.-H., O'Connor, M. J.,
RA  Bernard, H.-U.
RT  Nuclear matrix attachment regions of human papillomavirus
RT  type 16 repress or activate the E6 promoter, depending on
RT  the physical state of the viral DNA
RL  J. Virol. 74:2489-2501 (2000)
//