S/MARt DB - S/MAR

AC  SM0000160
XX
DT  7.5.1999 12:21:24 (created); ili
DT  18.6.2002 17:22:00 (updated); ili
XX
NA  HPV$E6-MAR
XX
OS  HPV-16, human papilloma virus type 16
OC  viridae; ds-DNA nonenveloped viruses; papovaviridae;
OC  papillomavirus
XX
SZ  631 bp
XX
DE  G000171; human papilloma virus type 16 E6 promoter
DP  24 - 654; Pos 1: genome numbering
DC  contains the E6 gene [1]
XX
SQ  CTAAGGGCGTAACCGAAATCGGTTGAACCGAAACCGGTTAGTATAAAAGCAGACATTTTA
SQ  TGCACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTTACCAC
SQ  AGTTATGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCA
SQ  AGCAACAGTTACTGCGACGTGAGGTATATGACTTTGCTTTTCGGGATTTATGCATAGTAT
SQ  ATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTAAAATTA
SQ  GTGAGTATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACA
SQ  AACCGTTGTGTGATTTGTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAG
SQ  AAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATATAAGGGGTCGGTGGACCG
SQ  GTCGATGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAGCTGTAATCAT
SQ  GCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGA
SQ  TCTCTACTGTTATGAGCAATTAAATGACAGC
SC  EMBL #K02718; nt 24-654
XX
FT  141 - 180: CDP binding [2]
FT  202 - 241: CDP binding [2]
FT  262 - 301: CDP binding [2]
FT  369 - 383: CDP binding [2]
FT  442 - 481: CDP binding [2]
XX
SF  can be reduced to a 456 bp fragment also containing the E6
SF  gene [1]
XX
BP  weak S/MAR [1]
XX
FF  acts in transient transfection as cis-responsive repressor
FF  on the E6 P97 enhancer-promoter [2]; strong
FF  cis-responsive activator in stable transfectants [2];
FF  CDP binding seems to cause repressive action in transient
FF  transfection [2]; interaction with CDP is suggested not
FF  to be responsible for the affinity of the MAR to the
FF  nuclear matrix and transcriptional activation after virus
FF  integration [2]
XX
CP  SiHa, HPK I, HPK II cells [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
BF  SB000079; CDP [2]
MM  direct gel shift; 
PR  several 40-mers representing the whole MAR [2]
SO  HeLa; human
QA  6
BF  SB000079; CDP [2]
MM  supershift (antibody binding); 
PR  probe represents pos. 374 to 403 of the virus genome [2]
SO  HeLa; human
QA  6
BF  SB000079; CDP [2]
MM  gel shift competition; 
PR  probe represents pos. 374 to 403 of the virus genome [2]
SO  HeLa; human
QA  6
XX
DR  EMBL: K02718; PA16
XX
RN  [1]
RX  MEDLINE; 98216720 PubMed; 9557642
RA  Tan, S.-H., Bartsch, D., Schwarz, E., Bernard, H.-U.
RT  Nuclear matrix attachment regions of human papillomavirus
RT  type 16 point toward conservation of these genomic elements
RT  in all genital papillomaviruses
RL  J. Virol. 72:3610-3622 (1998)
RN  [2]
RX  MEDLINE; 20148940 PubMed; 10684263
RA  Stuenkel, W., Huang, Z., Tan, S.-H., O'Connor, M. J.,
RA  Bernard, H.-U.
RT  Nuclear matrix attachment regions of human papillomavirus
RT  type 16 repress or activate the E6 promoter, depending on
RT  the physical state of the viral DNA
RL  J. Virol. 74:2489-2501 (2000)
//