S/MARt DB - S/MAR

AC  SM0000164
XX
DT  14.6.1999 17:39:34 (created); ili
DT  2.8.2004 10:49:00 (updated); ili2
XX
NA  HS$SOCS1-5MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1801 bp
XX
LO  16p13.13
DE  G001340; open reading frame
DN  Internal: n; Gene position numeral: -2
DC  possibly a pseudogene that locates between TNP2 and PRM2
DC  and has been named gene4 in [2]
DE  G001445; protamin 1
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -4
DE  G001446; protamine 2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -3
DE  G001447; transition protein 2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G001503; suppressor of cytokine signaling 1
DP  Direction: 5'; 2558 - ; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1
DE  G001504; 
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 2

G001445;
protamin 1
G001446;
protamine 2
G001340;
open reading frame
G001447;
transition protein 2
G001503;
suppressor of cytokine signaling 1
G001504;

XX
SQ  CATGCAGCAGGTCTGGGGTCAGAGCCTGGTCCCATCCTACCGAGCACTCTGAGCCCCTCA
SQ  GGGTTTCGCACTGCCTGGCTTCCTGTGAGCCTGGTGCCCAGCCCTCCAGGAGAACAGCCC
SQ  ACAAGGTGGATGCTTGTCAACCAGCAGATTTCCTTTTCTCTTTCGGCATCTGGATTTGGT
SQ  TTCATTTTGAACACAGGACTTCAGAAAATGAAACCAAAGCTGTCTGTCACTGGTGGCAGT
SQ  GAGGAGAACCCACGTGTGCTGAGTGTACCTTTAGAAGCTTTCCTGCTCCCTTGCTGTGCC
SQ  TTCCCTGGCCTGTGGTCCCTGGACTAGGGCTTCAAACATAGATATAAGGCAGTGCTTTGG
SQ  GAAGCCAGGGCAGGAGGGTCACTAAAGGACAGGAGTTCGAGACCAGCCTGGGCAACGTAG
SQ  TGAGACCCCATCCCTACAAAAATTTAAAAAATTAGCCGGGTGTGGTGGCATGTGCCTGTA
SQ  GTCTCAGCTACTCAGGAGGCTGAGATGGGAGAATCTCTTGAGCCCAGGAGGTCGAGGCTA
SQ  TAGTGCCTCCTCGATCCTATCACTACACTCCAGCCTGAGCAACAGAGCAACACTCCATCT
SQ  CTTTAAAAAAATGGACACAGGGGTTGAAGCCATGCGTCTGTGGGCTCCAACACACTGCCA
SQ  CACCCACAGGCACCCTCAGATGAACAACAAACATCTACCGACTGCTTATTAGACACTACG
SQ  GGCTGTTTTAAGCACCTGACCCATAATCACTCATTTAATTCCCATACAACCCCGGGATGG
SQ  AGGTACTATTTATTTATTTTTTTTTGAGACAGGGTCTTAGTCTGTTGCCCAGGCTGGAGT
SQ  GCAGTGACACAATCGTGGCTCACTGCAGCCTTGACCTCCTGGGCTCAGGCAATCCTCCTG
SQ  CTTCAGCCTCCCAAGTAGCTGGGACTGCAGGTGCAATCCACTACGACTGGCTGATTTTGT
SQ  ACTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTAGAGAGGGGGTCTCACTTTGTTGCC
SQ  CAGGCTGTTCTCAAACTCCTGGGCTCAAGCAATCCTCCTGTCTTGGCCTTCCAAGTGCTG
SQ  GGATTATAGGCATGAGCTACTGCGCCCTGCTAGAGGTACTATTATTATCCCCATTTCACA
SQ  GATAAAGAAACCATGGCAGAGAGGTTAATTACATGCTCAAGGTCACAAGAATAGAAAGGT
SQ  GCAGATTTGGAACTGGGTCTCCTTGTATTCCATCACCCTCCACAGAGTGTGGCCTCCAGC
SQ  AGATGTTCAGTGGACATCTCTCGAATGATCACACACCTGACCTCTGGTGCAGGCAAGGTT
SQ  CTGCATCTTCTCTCACCCCCTCACGCACGGCACGCACACACACGCACAACCTAGGAGGCT
SQ  ACACCAATGACCACCACCAGCCCTGGCCACATGCAGATTCAGGGCACTGATGGGGTGCTA
SQ  AGCTGGGCTGATTCTGGGCCACTCCCTGTGTTCAGGAGGTTAATAAGGACCTACGTCTGC
SQ  CTGGGGAAAGAGGCATCGTGGGGCCAGGGAGGCGGGAAGGGACTGGGCACCAGGGCTTCC
SQ  AGGAGAGAAGCCGTCTGAGAGCTGTCTGTAGAGGGCAGTGTGTCCCAGTGTGAGGCCAGT
SQ  AACCAAGTGCCCAGCCTAGCCAGGTTTTTATGTGGCCCCTTGTGATGCTGGGGCTCCTCA
SQ  CATGCCTTCATTCAAAAATACACGGAGCAGCCAGGCACCTACTCCATGGCCTCGCACGAC
SQ  AATCGGAATCACTAAATCACAAACACGTGTGCAAATTACAGCCCCGACCACCGACCGCCC
SQ  A
SC  EMBL #U15422; nt 37200-39000
XX
FF  somatic S/MAR [1] [2]; when multiple copies were
FF  tandemly integrated the number of formed loops was less
FF  than the number of introduced copies but the length of the
FF  loops observed in halo preparations was found constant
FF  [3]; not every copy of the S/MAR participates in gene
FF  expression when introduced into the mouse genome as
FF  head-to-tail tandemly arrayed transgene in multiple copies
FF  [3]
XX
EV  in vivo selection of S/MAR [2]
EV  flourescence in situ hybridization (FISH) [3]
EC  mind also comment on attachment in the Functional Features
EC  section
XX
DR  EMBL: U15422; HS15422
XX
RN  [1]
RX  MEDLINE; 99117956 PubMed; 9919312
RA  Kramer, J. A., Adams, M. D., Singh, G. B., Dogget, N. A.,
RA  Krawetz, S. A.
RT  A matrix associated region localizes the human SOCS-1 gene
RT  to chromosome 16p13.13
RL  Somat. Cell Mol. Genet. 24:131-133 (1998)
RN  [2]
RX  MEDLINE; 98390623 PubMed; 9723181
RA  Kramer, J. A., Adams, M. A., Singh, G. B., Dogget, N. A.,
RA  Krawetz, S. A.
RT  Extended analysis of the region encompassing the
RT  PRM1->PRM2->TNP2 domain: genomic organization, evolution
RT  and gene identification
RL  J. Exp. Zool. 282:245-253 (1998)
RN  [3]
RX  MEDLINE;  PubMed; 14996931
RA  Heng, H. H. Q., Goetze, S., Ye, C. J., LIU G., Stevens, J.
RA  B., Bremer, S. W., Wykes, S. M., Bode, J., Krawetz, S. A.
RT  Chromatin loops are selectively anchored using
RT  scaffold/matrix-attachment regions
RL  J. Cell Sci. 117:999-1008 (2004)
//