S/MARt DB - S/MAR

AC  SM0000165
XX
DT  14.6.1999 17:44:30 (created); ili
DT  27.2.2002 13:14:00 (updated); ili
XX
NA  HS$SOCS1-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2001 bp
XX
LO  16p13.13
DE  G001503; suppressor of cytokine signaling 1
DP  Direction: 3'; 10743 - ; Pos 1: ATG
DN  Internal: n; Gene position numeral: -2
DE  G001504; 
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DC  pseudogene locates about 17 kb to the end of the protamine
DC  domain [1]

G001503;
suppressor of cytokine signaling 1
G001504;

XX
SQ  ACTTGAGGCCCCCCGCCATCTGGCTTCAATGTACATTTCCAACCACACCTCATTCCTGTC
SQ  ACATTCCTCGTCTGCTCCCATTTACCCCAATTTCTCATGGTTCCCTAGGCCTTCCTAGCT
SQ  CCCCAGGGAAAGCCTTTGCTGTTTCCCTTGCTTTCTTTTCACTTGACAAACTCCTACTCA
SQ  ACCTTCAAAACCCAACTCAGCAAACATCTCCCCTAGGAAGCTCTCCTTAACTTTTTCTGC
SQ  TGGGTCCCGCTGCCTCTGCTAAAGTCCACGTGAGGGACTGCCAAGAGGTTTGCTCTGTCT
SQ  CACAGATTGAGTGCCAAGAGGGCAGGGACCTCTCTTTGAGAGAGTTTAACCTCTGTAACA
SQ  TAAGCAAGTTTACTTAATCACTGATTAAACCACTTTGTGCCTCAGTTTCCCCATTTGTTA
SQ  AGCATGAATTATCACTGTCACTATCTGCCAGGACTGTGAAGGGGGTGTAAATGCATGAAC
SQ  ATCATAAAGTGCTTAGAAGCATGCCTGGTACAAAGAAAGTTCTCTAGGAAAACAAAAAAC
SQ  AAAAAACAAACAAAAAAAAACAAAACAGAAATGTATCTAGAGGTCAGATACCAGTCCCAC
SQ  ATCGAGTGCAGATAATGGGCTAAGTAACCAAGGAGCAATGGAGACAAGGATGTAAATGGG
SQ  GTGGGGCACGATGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGAT
SQ  CACTTTAGGTCTGGAGTTTGAGACCAGCCTGGGCAACATGGCGAAACCCCGTCTCTACTA
SQ  AAAATACAAAAATTAGCCAGGTGTGGTGGTGTGTGCCAGTAATCCCATCTACTCTGGAGG
SQ  CTGAGGCAGGAGAATCACTTGAACCCAGGAGGCGGAGTTTGCAGTGAGTTAAGATTGCAC
SQ  CACTGCACTCCAGCCTGGGTGTCAGAGCAAGACTCCATCTCAAAAAGAGAAAAAAAAAAA
SQ  AATGCAATGGAGGAAAGGAGGAACCAGGGCACGGGGGTGAAGGAGACACTAACCCAGCCC
SQ  CTCCCTAAGTGCAGGTATGGTGTCCTGCCCCATTATGTGTCAGGCATAAAACTGGTGAAC
SQ  ATTTTCTTTCTTTTTTTTCCTCCAAATTCCTGGTTTAATAAAGACTTGTTTGTTTTGAGG
SQ  AAAAAAGTTCCCAAATATCAGGCTGTTCACAAAAATAACCCACAGTATCAACTTTAGAAA
SQ  ACAAATCTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTTGCCCAGGCTGGAGTGCA
SQ  GTGACACGATCTCAGCTCACTGCGAGCTCCGCCTCCTGGGTTCACGCCATTCTCCTGCCT
SQ  CAGCCTCCCAAGTAGCTGGGACTACAAGCGCCCGCCACCATGCCCGGCTGATTTTTTTTT
SQ  TTTTTTTTGTATTTTTTAGTAGAGACGGGTTTCACTGTGTTAGCCAGGATGGTCTCGATC
SQ  TCCTGACCTTGTGATCCGCCCGCCTTGGCCTCTCAAAGTGCTGGGATTACAGACGTGAGC
SQ  CACGGCGCCTGGCCTAGAAAACAAATCTTCAGACTATAACACTAATTATTTTTCTAGAGG
SQ  CTACATTTGACATGCCAACTCTCATTCACAAAAATACATTGTTACATTTGCATTTGTACA
SQ  TTGTTCATTGTTATGCATGCCAACTCTCATTCACAAAAATACATCGTTACGTTTGTACAT
SQ  TTGTTACATTGTGCATTGTTACACAGCAGACTAATGTAGGGGTGTAACACACATACTTCG
SQ  AACTCAAAGCTGCTTTCAGGAGCTGCTCAACTCAATGAGATTGCCTTTGCAGTTAGGAAA
SQ  GCAATTACTGAACTTACGTATGAATGAAAAGAACTGTACTCCCTGCACGACAAGATATTA
SQ  TTTTGGAAGCAGTTGATAACACCATACATCCTTTTTACTGTTAAAGTCATAAAGAGATAT
SQ  CAAAATTAAAAGCAAAAATTACAGGGTAAGACTTAACAAAACTACTAGGAGTGTCAAAGG
SQ  AAGTGAAAATGGGACTAGGCG
SC  EMBL #AC002286; nt 10029-12029
XX
FF  sperm specific [1]
XX
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: AC002286; HSAC2286
XX
RN  [1]
RX  MEDLINE; 98390623 PubMed; 9723181
RA  Kramer, J. A., Adams, M. A., Singh, G. B., Dogget, N. A.,
RA  Krawetz, S. A.
RT  Extended analysis of the region encompassing the
RT  PRM1->PRM2->TNP2 domain: genomic organization, evolution
RT  and gene identification
RL  J. Exp. Zool. 282:245-253 (1998)
//