S/MARt DB - S/MAR

AC  SM0000169
XX
DT  18.6.1999 18:22:37 (created); ili
XX
NA  MOUSE$GLOBA
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  456 bp
XX
DE  G000476; alphaA-globin
DP  Direction: 3'; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
XX
SQ  CTGCAGGTCCAAGACACTTCTGATTCTGACAGACTCAGGAAGAAACCATGGTGCTCTCTG
SQ  GGGAAGACAAAAGCAACATCAAGGCTGCCTGGGGGAAGATTGGTGGCCATGGTGCTGAAT
SQ  ATGGAGCTGAAGCCCTGGAAAGGTGAGAACAGGACCTTGATCTGTAAGGATCACAGGATC
SQ  CAATATGGACCTGGCACTCGCTCAGTGGGCAGCTTCTAACTATGCTTTTCTGTGACCTCA
SQ  ACTTCTCTTCTCTCCTTCTCCCAGGATGTTTGCTAGCTTCCCCACCACCAAGACCTACTT
SQ  TCCTCACTTTGATGTAAGCCACGGCTCTGCCCAGGTCAAGGGTCACGGCAAGAAGGTCGC
SQ  CGATGCGCTGGCCAGTGCTGCAGGCCACCTCGATGACCTGCCCGGTGCCTTGTCTGCTCT
SQ  GAGCGACCTGCATGCCCACAAGCTGCGTGTGGATCC
SC  EMBL #V00714; nt 358-813
XX
FF  caution: binding occurs only in vitro [1]
XX
EV  in vitro selection of S/MAR [1]
EC  liver nuclear matrices
XX
DR  EMBL: V00714; MMAGL1
XX
RN  [1]
RX  MEDLINE; 92118054 PubMed; 1731802
RA  Avramova, Z., Paneva, E.
RT  Matrix attachment sites in the murine alpha-globin gene.
RL  Biochem. Biophys. Res. Commun. 182:78-85 (1992)
//