S/MARt DB - S/MAR

AC  SM0000178
XX
DT  29.6.1999 13:18:24 (created); ili
DT  1.3.2002 16:28:00 (updated); ili
XX
NA  HS$GLOBAG-3MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  750 bp
XX
LO  11p15.5
DE  G000261; Agamma-globin
DP  Direction: 3'; 1957 - 2706; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DE  G000253; epsilon-globin
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -3
DE  G001095; Ggamma-globin
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DE  G001340; open reading frame
DP  Direction: 5'; Pos 1: ATG
DC  ORF identified as psi-beta globin pseudogene

G000253;
epsilon-globin
G001095;
Ggamma-globin
G000261;
Agamma-globin

XX
SQ  GAATTCAAGGTTTAGTCAGGTGTAGCAATTCTATTTTATTAGGAGGAATACTATTTCTAA
SQ  TGGCACTTAGCTTTTCACAGCCCTTGTGGATGCCTAAGAAAGTGAAATTAATCCCATGCC
SQ  CTCAAGTGTGCAGATTGGTCACAGCATTTCAAGGGAGAGACCTCATTGTAAGACTCTGGG
SQ  GGAGGTGGGGACTTAGGTGTAAGAAATGAATCAGCAGAGGCTCACAAGTCAGCATGAGCA
SQ  TGTTATGTCTGAGAAACAGACCAGCACTGTGAGATCAAAATGTAGTGGGAAGAATTTGTA
SQ  CAACATTAATTGGAAGGTTTACTTAATGGAATTTTTGTATAGTTGGATGTTAGTGCATCT
SQ  CTATAAGTAAGAGTTTAATATGATGGTGTTACGGACCTGGTGTTTGTGTCTCCTCAAAAT
SQ  TCACATGCTGAATCCCCAACTCCCAACTGACCTTATCTGTGGGGGAGGCTTTTGAAAAGT
SQ  AATTAGGTTTAGCTGAGCTCATAAGAGCAGATCCCCATCATAAAATTATTTTCCTTATCA
SQ  GAAGCAGAGAGACAAGCCATTTCTCTTTCCTCCCGGTGAGGACACAGTGAGAAGTCCGCC
SQ  ATCTGCAATCCAGGAAGAGAACCCTGACCACGAGTCAGCCTTCAGAAATGTGAGAAAAAA
SQ  CTCTGTTGTTGAAGCCACCCAGTCTTTTGTATTTTGTTATAGCACCTTACACTGAGTAAG
SQ  GCAGATGAAGAAGGAGAAAAAAATAAGCTT
SC  EMBL #U01317; nt 41373-42122
XX
FT  41399 - 41452(EMBL): SATB1 binding [1]
FT  41672 - 41707(EMBL): SATB1 binding [1]
XX
SF  contains binding motifs for several transcription factors
SF  [1]
XX
FF  coincides with 3' Agamma globin regulatory element [1]
XX
EV  in vitro selection of S/MAR [1]
XX
BF  SB000012; SATB1 [1]
MM  direct gel shift; 
PR  nt 41399-41452, nt 41672-41707
SO  K562; human
QA  6
BF  SB000012; SATB1 [1]
MM  supershift (antibody binding); 
PR  nt 41399-41452
SO  K562; human
QA  6
BF  SB000012; SATB1 [1]
MM  gel shift competition; 
PR  nt 41399-41452
SO  K562; human
QA  6
XX
DR  EMBL: U01317; HSHBB
XX
RN  [1]
RX  MEDLINE; 94325576 PubMed; 8049444
RA  Cunningham, J. M., Purucker, M. E., Jane, S. M., Safer, B.,
RA  Vanin, E. F., Ney, P. A., Lowrey, C. H., Nienhuis, A. W.
RT  The regulatory element 3' to the gammaA-globin gene binds
RT  to the nuclear matrix and interacts with special A-T-rich
RT  binding protein (SATB1), an SAR/MAR-associating region DNA
RT  binding protein
RL  Blood 84:1298-1308 (1994)
//