S/MARt DB - S/MAR

AC  SM0000186
XX
DT  1.7.1999 15:39:46 (created); ili
DT  10.12.2004 14:22:00 (updated); ili2
XX
NA  CHA$DHFR-3MAR3
XX
OS  chinese hamster, Cricetulus longicaudatus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha;
OC  cricetidae; cricetinae; cricetini.
XX
SZ  378
XX
LO  2
DE  G001234; dihydrofolate reductase
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DC  Pvu II fragment about 28 kb downstream of DHFR [1]
DE  G013649; 
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G001234;
dihydrofolate reductase
G013649;

XX
SQ  CTGACAGGGAGCGGTCACCAAACTTTTTTTTCTGTAAAGTGACAAAAATAGTTAAGTATT
SQ  TTGCCCTAGACATAGTGGGTGGTACACATGTAATCTCAGCATTTGTCAGAGTGAGGCAGA
SQ  GAGTTGAATGCTGGGCTACGTAGATAGTCTCAAAAAATAAATAAATAAGTAAATAAATAA
SQ  ATAAATAAATAAAAGGAAGAAATAAAAAAAAGAATTTGTTACTCAACTCTGACAATGGTG
SQ  GAAAAGAAACAATAAGCATTATGTAACCTAGTGGGTATTGGCTGTTTCACTTTACTAACA
SQ  GGCATTGAAATTTCAATTTTGCAAAATTTTCATGTTCCATATTACCCTTATTTTTATTCT
SQ  CCCCTATAAATGGTGACT
SC  [4]
XX
FT  1 - 378: matrix binding [4]
FT  139 - 270: strong matrix binding [4]
FT  149 - 226: AT-rich core [4]
XX
FF  locates to an intergenic spacer comprising 3 preferred
FF  origins of replication which surround the MAR and a large
FF  number of additional replication initiation sites [13717,
FF  25234]
XX
CP  CHOC 400, CHO [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
EC  matrix binding of a 3400 bp Pvu II [1]; matrix binding
EC  was narrowed down to the 378 bp Pvu II-Hinf I fragment
EC  [4]
EV  in vivo selection/high salt [1]
EV  re-binding assay (LIS) [4]
EC  bp 139-270 showed matrix binding in the presence of cold
EC  unspecific competitor DNA [4]
XX
RN  [1]
RX  MEDLINE; 89219000 PubMed; 3244360
RA  Dijkwel, P. A., Hamlin, J. L.
RT  Matrix attachment regions are positioned near replication
RT  intiation sites, genes and an interamplicon junction in the
RT  ampified dihydrofolate reductase domain of chinese hamster
RT  ovary cells
RL  Mol. Cell. Biol. 8:5398-5409 (1988)
RN  [2]
RX  MEDLINE;  PubMed; 2725490
RA  Foreman, P. K., Hamlin, J. L.
RT  Identification and characterization of a gene that is
RT  coamplified with dihydrofolate reductase in a
RT  methotrexate-resistant CHO cell line
RL  Mol. Cell. Biol. 9:1137-1147 (1989)
RN  [3]
RX  MEDLINE;  PubMed; 10739662
RA  Dijkwel, P. A., Mesner, L. D., Levenson, V. V., d'Anna, J.,
RA  Hamlin, J. L.
RT  Dispersive initiation of replication in the Chinese hamster
RT  rhodopsin locus
RL  Exp. Cell Res. 256:150-157 (2000)
RN  [4]
RX  MEDLINE;  PubMed; 12629222
RA  Mesner, L. D., Hamlin, J. L., Dijkwel, P. A.
RT  The matrix attachment region in the Chinese hamster
RT  dihydrofolate reductase origin of replication may be
RT  required for local chromatid separation
RL  Proc. Natl. Acad. Sci. USA 100:3281-3286 (2003)
//