S/MARt DB - S/MAR

AC  SM0000189
XX
DT  1.7.1999 17:49:26 (created); ili
XX
NA  RAT$AMGL-3MAR1
XX
OS  rat, Rattus norvegicus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae;
OC  murinae
XX
SZ  1090 bp
XX
DE  G000699; alpha2-macroglobulin
DP  Direction: 3'; 123 - 1212; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  maps to a Taq I fragment within the first intron [1]
XX
SQ  TCGATTTAGGGTTTCTGTTTACTCGTTTCTTAAAACCATGACCTTCTTTCTCATCTCCGA
SQ  GATTCTGAGATTTTTCCAAACCTTCCTCAGTCATTCTTCCTCCTCAATACAGTTTTAATC
SQ  ATTTCTCTCTAGCTCTCTGGATTTCGCGATATCCAAACTCCCCCACTGGACATGTAGGAC
SQ  CTTTCTAGGTACTTGTGTCTTCAGATCCTAATGTGGCTCTGTTGAGACTTTGTCCTTGCT
SQ  GCCCCCTTTACATTCCTCTGTCGGTTTGACAGAAAAGACACGCCTCTCCAGCGTGCGTTT
SQ  TGTCCCTGGGTTTAAAATCCCCTAGGAATGATTTCAAACGTTGATGTTGATGCTGAAAAT
SQ  GCAAACGACTTTTGTTATGGAGAAAAACTATTGTGTGCAAATAAGCTAGCGATGGATTCT
SQ  GTGTTTCAAAGAAATGAACCAAGGAGAGTAGACAGCCAGACAGATGGCTGGAACAATACT
SQ  TGGGAGCACTGGTTCTGGCTGATTTAGAGCAGGTTATACAAGAGGAACGGTGACAAAGAG
SQ  GTAGTTACTGGAGGCTTTTTCTTCGGGCCTATATTTACAGATAAGACGAATGTTATTGTT
SQ  TTAATGAGGCAAACCAGCTCAGGGTCATCATCAATGCTCACGGTGGGAGAGGAGCACACA
SQ  CAATTCTCAACAGAGATGTGCTGTGAGAGTATCTCACTTTTACGTCTAATATATATGGGC
SQ  CATGAACATATTTTTAGTAAGTTATGTACTAGAACTTCTGAAAATAATCCAATCATAAGA
SQ  AAGCATTTAACACTTACTAATTTATGGGCACATATATAAAACAGGAGTTACTGTTAGACT
SQ  TACGTATCCACAGGTGATATTTCTTGTACATTTATCTGTTAATAAAAAAAAATGAGAATT
SQ  GTTCATGAGTTATTTTGCAGCATAAAGAAATCATAGTATAAACTCTGGATAATAGTAAGT
SQ  GGCACAAAAATTAGAATTTTTTGAGCATTACAAAAAGAAACCTATACATTTTATTTATTT
SQ  ATTATTTTCTCTCGTTGTTCATTTGTTTGTTTTGAGACAGGATTTTGCTAAGGGTGCCTG
SQ  ACAGCATCGA
SC  EMBL #M23567; nt 4721-5810
XX
FT  5288 - 5810(EMBL): preferential matrix attachment [1]
XX
SF  4 sites with similarity to topoisomerase II consensus of
SF  Drosophila [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: M23567; RRA2MAC1
XX
RN  [1]
RX  MEDLINE; 88106458 PubMed; 2447878
RA  Ito, T., Sakaki, Y.
RT  Nuclear matrix association regions of the rat
RT  alpha2-macroglobulin gene
RL  Biochem. Biophys. Res. Commun. 149:449-454 (1987)
//