S/MARt DB - S/MAR

AC  SM0000191
XX
DT  2.7.1999 16:39:02 (created); ili
DT  8.12.1999 14:02:11 (updated); ili
XX
NA  SOYBN$hsp17-3MAR
XX
SY  Gmhsp17.6-L, 
XX
OS  soybean, Glycine max
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; rosidae; fabales; fabaceae
XX
SZ  401 bp
XX
DE  G001520; heat shock protein of 17.6 kDa, Gmhsp 17.6L
DP  Direction: 3'; 890 - 1290; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1

G001520;
heat shock protein of 17.6 kDa, Gmhsp 17.6L

XX
SQ  GTTAACTAGCAAGTTCAGAGCATCATTTAAGTAATTAAAAGAAAAAATATTAAATATATA
SQ  AATCATAAGATGATATCAAAAAATTCATGAACAGTCTCTTCATTTTTTTTCAATAAAAAT
SQ  ATTTTTATTTTAATTTTTTAAAATAATATCCTCATAACATTGGTTTAACTCCCAAGTTTA
SQ  AAATTTACTAGTGCTAGATAAATTCTCTAAGATAATGTATAGATAAAAATAAGATAAATT
SQ  AGAAAATTTTTAAGGAGAGATTTTTTTTTATAAAAATTAGGTATATGTATTGGTTTTAGT
SQ  TTACAGAGAAATATAATTTATATTTTCTTTTTGTGTAAATATTAATGAAAAAAATTATTC
SQ  AAATTCAATTCTAAATCTTAATATTTTTTTTGACAGAATTC
SC  EMBL #M11317; nt 1310-1710
XX
SF  1 site similar to topoisomerase II consensus [1],
SF  AATATTTTT and ATATTT motifs [1]
XX
FF  heat-inducible reporter gene in tobacco shows enhanced,
FF  gene dosage dependent expression [1]
XX
EV  in vitro selection of S/MAR [1]
XX
BF  SB000056; MARBP-1 [2]
MM  Southwestern blotting / filter binding; 
SO  rec(pea-E.coli); pea
QA  6
BF  SB000056; MARBP-1 [2]
MM  replacement by distamycin A; 
SO  rec(pea-E.coli); pea
QA  6
BF  SB000057; MARBP-2 [2]
MM  Southwestern blotting / filter binding; 
SO  leaf; pea
QA  6
BF  SB000057; MARBP-2 [2]
MM  replacement by distamycin A; 
SO  leaf; pea
QA  6
XX
DR  EMBL: M11317; GMHSP176
XX
RN  [1]
RX  MEDLINE; 93291895 PubMed; 8513340
RA  Schoeffl, F., Schroeder, G., Kliem, M., Rieping, M.
RT  An SAR sequence containing 395 bp DNA fragment mediates
RT  enhanced, gene-dosage-correlated expression of a chimeric
RT  heat shock gene in transgenic tobacco plants
RL  Transgenic Research 2:93-100 (1993)
RN  [2]
RX  MEDLINE; 99334628 PubMed; 10406125
RA  Hatton, D., Gray, J. C.
RT  Two MAR DNA-binding proteins of the pea nuclear matrix
RT  identify a new class of DNA-binding proteins
RL  Plant J. 18:417-429 (1999)
//