S/MARt DB - S/MAR

AC  SM0000198
XX
DT  2.7.1999 18:01:43 (created); ili
DT  15.11.1999 15:33:20 (updated); ili
XX
NA  NT$MAR7
XX
OS  tobacco, Nicotiana tabacum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  306 bp
XX
SQ  GGATCCAGCTATTATTATAGCATGTGAGTTGTCCGTGAACAGCTAATTTTTTACCACACC
SQ  CAAATTCAATACTATTTTAGTGTAAATATATCTTTTAGGTCTAGTCTTAATATTTAACTT
SQ  TTTGTCTTACTTTTAATAGATTTTATTTGAGAAAAATTAATAATTACAAAAAATAAAAAG
SQ  TATATATTCACATACTTATAGTACAAACTTTGTTTCTATTTATAAAGAGAAAAAGAAATT
SQ  TTACAAAAAACAAATATATTTGCTTTCTTTTAATTAGTAGTTTTATTAAGCAAGCTATAG
SQ  AAGCTC
SC  EMBL #AF065883
XX
BP  60% [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AF065883; AF065883
XX
RN  [1]
RX  MEDLINE; 99435753 PubMed; 10504249
RA  Michalowski, S. M., Allen, G. C., Hall jr, G. E., Thompson,
RA  W. F., Spiker, S.
RT  Characterization of randomly-obtained matrix attachment
RT  regions (MARs) from higher plants
RL  Biochemistry 38:12795-12804 (1999)
//