S/MARt DB - S/MAR

AC  SM0000205
XX
DT  5.7.1999 17:01:37 (created); ili
DT  17.7.2000 11:17:48 (updated); ili
XX
NA  DROME$gypsy
XX
OS  fruit fly, Drosophila melanogaster
OC  eukaryota; animalia; metazoa; arthropoda; insecta; diptera;
OC  drosophiloidea; drosophilidae
XX
SZ  363 bp
XX
SQ  GAATTTATTCGCAAAAACATTGCATATTTTCGGCAAAGTAAAATTTTGTTGCATACCTTA
SQ  TCAAAAAATAAGTGCTGCATACTTTTTAGAGAAACCAAATAATTTTTTATTGCATACCCG
SQ  TTTTTAATAAAATACATTGCATACCCTCTTTTAATAAAAAATATTGCATACTTTGACGAA
SQ  ACAAATTTTCGTTGCATACCCAATAAAAGATTATTATATTGCATACCCGTTTTTAATAAA
SQ  ATACATTGCATACCCTCTTTTAATAAAAAATATTGCATACGTTGACGAAACAAATTTTCG
SQ  TTGCATACCCAATAAAAGATTATTATATTGCATACCTTTTCTTGCCATACCATTTAGCCG
SQ  ATC
SC  EMBL #M12927; nt 670-1032
XX
FT  685 - 690(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  687 - 698(EMBL): su(Hw) binding motif [2]
FT  716 - 727(EMBL): su(Hw) binding motif [2]
FT  742 - 753(EMBL): su(Hw) binding site [2]; 
FT  777 - 788(EMBL): su(Hw) binding motif [2]
FT  790 - 807(EMBL): ATC sequence repeat [2]
FT  802 - 807(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  804 - 815(EMBL): su(Hw) binding motif [2]
FT  818 - 834(EMBL): ATC sequence repeat [2]
FT  829 - 834(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  831 - 842(EMBL): su(Hw) binding motif [2]
FT  859 - 870(EMBL): su(Hw) binding motif [2]
FT  884 - 889(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  886 - 897(EMBL): su(Hw) binding motif [2]
FT  899 - 916(EMBL): ATC sequence repeat [2]
FT  911 - 916(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  913 - 924(EMBL): su(Hw) binding motif [2]
FT  927 - 943(EMBL): ATC sequence repeat [2]
FT  938 - 943(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  940 - 951(EMBL): su(Hw) binding motif [2]
FT  968 - 979(EMBL): su(Hw) binding motif [2]
FT  993 - 998(EMBL): core consensus motif for topoisomerase II
FT                   [2]
FT  995 - 1006(EMBL): su(Hw) binding motif [2]
XX
SF  AT-rich [2]; matrix binding inhibited by distamycin
SF  [2]
XX
CH  insulator [2]
XX
FF  decreases reporter gene expression [2]
XX
EV  in vitro selection of S/MAR [2]
EC  reassociation with matrices from HeLa, murine L and
EC  Drosophila S II cells [2]
XX
BF  SB000048; topoisomerase II [2]
MM  sedimentation assay; 
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000048; topoisomerase II [2]
MM  topoisomerase II cleavage assay; 
SO  yeast, extract; baker's yeast, Saccharomyces cerevisiae
QA  6
BF  SB000049; H1 [2]
MM  sedimentation assay; 
SO  thymus; calf
QA  6
BF  SB000050; su(Hw) [1]
MM  DNase I footprinting; 
PR  326 bp fragment
SO  rec(Dros.-yeast); Drosophila melanogaster
QA  6
XX
DR  EMBL: M12927; DMGYPF1A
DR  EMBL: AF033821; AF033821
XX
RN  [1]
RX  MEDLINE; 94344073 PubMed; 8065301
RA  Anderson, M. G., Dynan, W. S.
RT  The enhancer-blocking suppressor of Hairy-wing zinc finger
RT  protein of Drosophila melanogaster alters DNA structure
RL  Mol. Cell. Biol. 14:5645-5652 (1994)
RN  [2]
RX  MEDLINE; 98113221 PubMed; 9442099
RA  Nabirochkin, S., Ossokina, M., Heidmann, T.
RT  A nuclear matrix/scaffold attachment region co-localizes
RT  with the gypsy retrotransposon insulator sequence
RL  J. Biol. Chem. 273:2473-2479 (1998)
//