S/MARt DB - S/MAR

AC  SM0000206
XX
DT  6.7.1999 14:16:31 (created); ili
DT  23.11.2000 18:12:18 (updated); ili
XX
NA  GG$CMYC-5MAR
XX
OS  chick, Gallus gallus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; aves;
OC  neornithes; neognathae; galliformes; phasianidae
XX
SZ  1023 bp
XX
DE  G000073; 
DP  Direction: 5'; 583 - 102; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G000073;

XX
SQ  CCGGGGGTCACCTTGCAGCCGCTCCCCCCGCAGCCTCCTCCTCCCGTTTAATCCTCCGGG
SQ  ATAACGAAGCAGCGACACGGGCGGGGGTGCGCGAGCTACGGACGCTCCTTTGTGCCGGTA
SQ  GGGTAGCCGGCAACCGCCCCGCCCGCAGCCGCGTTACGGGTGGACACGGAGCGTGAACCT
SQ  CCCCTGCCGCCGTCGGGGGGCAGCGGGAGGAGGGGGAGCGGAGAGCGAGGAGGGAAGGAG
SQ  GGAGGGGGGAAGGCAGCGAGGAGGGAAGCAGCGAGGAGCGCCCTTTTCATCCCCGCTCGT
SQ  ATTTTTTTTTTTTTTTTACTATGTTTACTTCCGACCTCTCCTTGTAGTAGGAAAAAAAAC
SQ  CAACCGCTGCTCCGCATCGCCTCTCCCCGGCCCCTCTCCCTCCCTCCCTCCCTCCCGCCC
SQ  GCCCAGCTCCGGCTCGCAGTACTCGGGGGGGGGCACGGAGCCCCTCGGCCGCCCCCTCGC
SQ  GGCGCGCCCTCCCCGCTCACGGAGCCCGCGCGGAGCCGGGGGCGAGCGGGAGGGAGATGA
SQ  AGCGGCGACGCGCACCGCGAGAGCGCGCACTCGCGGGGCCCCGCCGTGCCGCTCGTGCTC
SQ  CCGCCCCCGCTGCATCTCCCGCCCGCCCCTCGCCGGCGCTTTAAAGACAGCAAAGCAACT
SQ  TAACTTCTATTGTACCGGACGGAGCGCGCCGCGCCGCCTTGGACCGTACAATCTGCCGCA
SQ  CGCCGGGAAGGCGAGCCCTCTCCGCTGTATTTTTTTTCTCATCGTGGTGGGAGGAAGCGA
SQ  TCTACGTTCTCCCGGCGTTTTGGCTCCCTTTTTTCCCCCGTCTTCTCCGGCGGTTCTTTT
SQ  TATATTTTTATCTCCAATTTCCTGATTTTGTTGTTCCCCGCACCGCCCGCAATTATTGCC
SQ  TCGCTCCGTCTCGCAGCCGGCGCGTTGGAGGAGCCGGTGAGTGGCGGGGCTCCGCTTTAC
SQ  CCATCACTCGATCCGCCGCGGTCGGGCTGACAGCGCGGGGCCGCGGGACCGCCGGTGCCT
SQ  CCC
SC  EMBL #J00889; nt 527-1549
XX
FT  620 - 1101(EMBL): matrix binding [2]
FT  800 - 854(EMBL): minimal RBF-binding element [2]
XX
EV  in vivo selection of S/MAR [1]
EC  subfragments -583 to -423, -422 to -252 and -251 to -102
EC  also tested for matrix binding [2]
EP  -676 to +345 relative to transcriptional start (13732]
XX
BF  SB000051; RBF [2]
MM  direct gel shift; 
PR  -404 to -320 relative to transcriptional start
SO  rec(chick-E.coli); chicken
QA  6
BF  SB000051; RBF [2]
MM  supershift (antibody binding); 
PR  -404 to -320 relative to transcriptional start
SO  rec(chick-E.coli); chicken
QA  6
BF  SB000051; RBF [3]
MM  gel shift competition; 
PR  -404 to -350 relative to transcriptional start, double
PR  stranded and single stranded; -404 to -340 relative to
PR  transcriptional start, double stranded and single stranded
SO  rec(chick-E.coli); chicken
QA  6
BF  SB000051; RBF [2]
MM  southwestern blotting; 
PR  -404 to -350 relative to transcriptional start
SO  rec(chick-E.coli); chicken
QA  6
XX
DR  EMBL: J00889; GGMYC
XX
RN  [1]
RX  MEDLINE; 91369975 PubMed; 1892850
RA  Schuchard, M., Subramaniam, M., Ruesink, T., Spelsberg, T.
RA  C.
RT  Nuclear matrix localization and specific matrix DNA binding
RT  by receptor binding factor 1 of the avian oviduct
RT  progesterone receptor
RL  Biochemistry 30:9516-9522 (1991)
RN  [2]
RX  MEDLINE; 97451002 PubMed; 9305935
RA  Lauber, A. H., Barrett, T. J., Subramaniam, M., Schuchard,
RA  M., Spelsberg, T. C.
RT  A DNA-binding element for a steroid receptor-binding factor
RT  is flanked by dual nuclear matrix DNA attachment sites in
RT  the c-myc gene promoter
RL  J. Biol. Chem. 272:24657-24665 (1997)
RN  [3]
RX  MEDLINE; 20117380 PubMed; 10651641
RA  Barrett, T. J., Sandhu, N. P., Tomlinson, A. J., Benson, L.
RA  M., Subramaniam, M., Naylor, S., Spelsberg, T. C.
RT  Interactions of the nuclear matrix-associated steroid
RT  receptor binding factor with its DNA binding element in the
RT  c-myc gene promoter
RL  Biochemistry 39:753-762 (2000)
//