S/MARt DB - S/MAR

AC  SM0000207
XX
DT  7.7.1999 18:28:05 (created); ili
XX
NA  RICE$NB-1
XX
OS  rice, Oryza sativa
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  liliopsida; commelinidae; cyperales; poaceae
XX
SZ  442 bp
XX
SQ  TCAATCCCGCATGGGAGATTCCAAGCGCCAGACTGACAGATTGACCTTGTCCCCCCCTCA
SQ  CAAACTTACACAAAACCCTTAAAACATTCAAAATTCACAAATAGCTCCCTATAGGGGCTG
SQ  AAATGTAAGACCTCGCTTCGGACAAGCCGACCCCGCCTGCTATTTCCCGAAACTCCAAGC
SQ  CCTTGTATGAAAAAACGCCGTCTTCCTGTAGTGGGTGGTGGAAGAAGGGAATAAAAAAAC
SQ  AAAGAGGAAAAAAAAGGAAGGTCTCATCTCATGGTCGCCTAGCCAAGCCAAGCCAACCTC
SQ  CTCGCCGAGGAGAGAGAAGAGAGGAGAGGAGACGAGAGGAGAGAGAAGCCGAGGAGGAGG
SQ  AGAGAGAGAGAGGAGGCCGCTCCNTTTGCCCCCCCCCCCCCCCATGGGGACNCTGCCGGG
SQ  GGGGGGCCCCCCCCCCGGANGG
SC  [1]
XX
FT  230 - 239: A-box [1]
XX
SF  sequence is incomplete, should comprise about 1030 bp [1]
XX
CP  (suspension cultured cells from embryo) [1]
XX
EV  in vivo selection of S/MAR [1]
XX
RN  [1]
RX  MEDLINE; 98024654 PubMed; 9360323
RA  Nomura, K., Saito, W., Ono, K., Moriyama, H., Takahashi,
RA  S., Inoue, M., Masuda, K.
RT  Isolation and characterization of matrix associated region
RT  DNA fragments in rice (Oryza sativa L.)
RL  Plant Cell Physiol. 38:1060-1068 (1997)
//