S/MARt DB - S/MAR

AC  SM0000208
XX
DT  8.7.1999 12:07:24 (created); ili
DT  27.5.2002 13:27:00 (updated); ili
XX
NA  PH$TBS
XX
SY  petunia transformation booster sequence, 
XX
OS  Petunia hybrida
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  522 bp
XX
SQ  AAGCTTGATGTTCCACTGCCTTGATGCTTGCTTTAAACCATAGAGAGACTTTCAACAGCC
SQ  TGCACACCTTGGTCCCCCTTGGCTGTGAAAACCCTGAGGCAGAGACATATAAACTTCTTC
SQ  CATGAGGTCACCTTGTAGAAAAGCATTGTTAACATCCATCTGGAAAAGGAACCAGCCCTT
SQ  GGAAGCAGCATACAGATATGACCAGCTTTTACAGGTGACCATTTTGGCCACTGGAGAAAA
SQ  GGTTTCATGGTAGTCAAGGCCTTCTTGTTGCAGTGTATCCCTTGGCCACTAGCCTGGCCT
SQ  TAAACCTGTCAACTTCACCATTAGCTTTGTATTTAATTTTGTTACACCCATTTGGACCCT
SQ  ATAGGTTGTTTACCAGGGGGTAAAGGGACAATCTCCAGTGTCTCATTATCCTCAAGAGCC
SQ  TGTATCTCAAGGGACATGGCCTCCATCCATTTCTCATCTTGAGCTGCTTCTTTTGAAGGA
SQ  TTTAGGTTCAGTATAAGTGGTAGAAAGCACTCAAATAAGCTT
SC  EMBL #M23378; nt 580-1101
XX
SF  contains DNA unwinding elements, sites displaying homology
SF  to the Drosophila topoisomerase II consensus and pyrimidine
SF  tracts [1]; high and sequence-specific variability
SF  observed between different petunia varieties [1]; may
SF  be an inactive derivative of a retrovirus [1]
XX
FF  note: no specific binding to barley nuclear scaffolds
FF  [2]; no significant effects on the level or variance of
FF  transgene expression in barley [2]; enhances homologous
FF  recombination about twofold [1]; enhances
FF  transformation in petunia, tobacco, maize and barley
FF  [1] [2]
XX
EV  in vitro selection of S/MAR [1]
EC  petunia nuclear scaffolds
XX
DR  EMBL: M23378; PHTBS
XX
RN  [1]
RX  MEDLINE; 95327058 PubMed; 7603441
RA  Galliano, H., Mueller, A. E., Lucht, J. M., Meyer, P.
RT  The transformation booster sequence from Petunia hybrida is
RT  retrotransposon derivative that binds to the nuclear
RT  scaffold
RL  Mol. Gen. Genet. 247:614-622 (1995)
RN  [2]
RX  MEDLINE; 22002556 PubMed; 12008898
RA  Petersen, K., Leah, R., Knudsen, S., Cameron-Mills, V.
RT  Matrix attachment regions (MARs) enhance transformation
RT  frequencies and reduce variance of transgene expression in
RT  barley
RL  Plant Mol. Biol. 49:45-58 (2002)
//