S/MARt DB - S/MAR

AC  SM0000212
XX
DT  11.10.1999 17:49:18 (created); ili
DT  12.10.1999 11:09:36 (updated); ili
XX
NA  NT$CHN50-5MAR2
XX
SY  S/M I, 
XX
OS  tobacco, Nicotiana tabacum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  700 bp
XX
DE  G001540; endochitinase
DP  Direction: 5'; 3320 - 2621; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G001540;
endochitinase

XX
SQ  AGCTTTCTTGAATTCTTACGTGTGTCAATTTCAATATTTTATAATTTTGTGCGTTTGTTT
SQ  TATAATTAATTATTTAATTTGACAGAGTATATACCTATGGGTTCCAGACTCGATATTTGA
SQ  GGTCCAGTAGCACCAAGCTATCCTAAATTCTTATATGTGTCAATTTTAATATTTTTCATA
SQ  ATTTTGTGTGTTTGTTTTATAAATTAAATAATTAATTTTGTAAATTATAATTGGACAAAG
SQ  TTTGTGTTTGATCTATCAATATAGTAGATACTTAAACTACAGGGATTCTACGCTAAAAGG
SQ  CTCTACATTTTACTATGCTAAAAAACTCTATATTTTACTACGCTAAAAGGGCAGTAGTCT
SQ  TTAAGCAAATAAATAATCTAAACTAAATAAAAATAACAAATATATTTTAATAACATAACA
SQ  TTCACGAAATTTATATAAAACAGTAAAAGAAATTTATGAACATTTTTATTAACAAAAAAA
SQ  ATTATTTCTCAACTTTTAACTATTTTTTAAAACACTAATATCTTAATCCGGATAAAAATA
SQ  ACATACTAGTTTAATCGCAAACAAAACACAAAACAACATGGAAACACATTCAAGACAACT
SQ  AATATGCATTATTATATAAGTTTCGACATAAACTGAAATCGGAATACCTCGATTTATGCT
SQ  TTTAGGAAAGTCAAAAAATTAAAATTTTGAGCCCGAAACG
SC  EMBL #AJ006034; nt 1-700
XX
FT  368 - 377: motif similar to A-box [1]
FT  382 - 391: motif similar to A-box [1]
FT  399 - 407: base unpairing region [1]
FT  568 - 585: vertebrate topoisomerase II consensus site
FT               [1]
XX
SF  motifs similar to ARS consensus sequence from yeast [1];
SF  T-box motifs, AT tract >9 nt and 2 ATC tracts > 29 nt
SF  [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AJ006034; NTA6034
XX
RN  [1]
RX  MEDLINE; 99274006 PubMed; 10344209
RA  Fukuda, Y.
RT  Characterization of matrix attachment sites in the upstream
RT  region of a tobacco chitinase gene
RL  Plant Mol. Biol. 39:1051-1062 (1999)
//