S/MARt DB - S/MAR

AC  SM0000213
XX
DT  11.10.1999 17:50:21 (created); ili
DT  13.12.2001 14:02:00 (updated); ili
XX
NA  NT$CHN50-5MAR1
XX
SY  S/M II, 
XX
OS  tobacco, Nicotiana tabacum
OC  eukaryota; viridiplantae; embryobionta; magnoliophyta;
OC  magnoliopsida; asteridae; solanes; solanaceae
XX
SZ  651 bp
XX
DE  G001540; endochitinase
DP  Direction: 5'; 2221 - 1371; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1

G001540;
endochitinase

XX
SQ  ACATTATCAGTGGAAATATTATATTATATCCATGTTAGATTGATACTTTTCAGAAGACGC
SQ  ACTTAACTAACCCAAGAAACACCTGGCGTAACTCGACTGTGCTTTTTTGCCAAAACCAAA
SQ  AAACTAGGCATTAAGCTCTCATGTTGTACATAGATTTTCGCTATTTTTAAAATAAAATTA
SQ  AAAACATTTAGTTTTTTCATGAAATTTGTTTTGAAGTTCTAAAAACTAGCTTGGGCCAGT
SQ  TTTTGGGTGAAGTTTTTTCTTCCACTCACAAAACTTCAATTTTTTTCCAAGTAAAATGCA
SQ  TGTTCAAACATAAATTCAAATTCCAAAAACTATTTTTCAACATAATTTAAAAACTTTTTT
SQ  TCAAGTTCTAACTAAATTTATATCCAAACACTAACTAAGTGGGCGCTTGGATATAAAAAT
SQ  TGTAAAATTCCAAAAAAATAGTGAAAACTATTTTCAAGTGGAAATGATATTTGAAAATTA
SQ  GAGTTGTGTTTGGATATGAATATGATTTTGGGTTGTTTTTGAAGTTTTGTGAGTAATCTG
SQ  AATGAAAATTTTGAAAAATAGCTTTTTGGAGTTTTTCAAAATTTCAAAAAATTCCCAAAA
SQ  TACATCTTCAAATGAAAATTGAAAATTTTATGAACAAACGTTGATTTCGAA
SC  EMBL #AJ006034; nt 1300-1950
XX
FT  236 - 300: curved region [2]
FT  236 - 285: necessary for protein binding [2]
FT  255 - 263: center of curved region [1] [2]
XX
SF  motifs similar to ARS consensus sequence from yeast [1];
SF  T-box motifs, AT tracts > 9 nt and 7 ATC tracts >29 nt
SF  [1]
XX
BP  strong [2]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AJ006034; NTA6034
XX
RN  [1]
RX  MEDLINE; 99274006 PubMed; 10344209
RA  Fukuda, Y.
RT  Characterization of matrix attachment sites in the upstream
RT  region of a tobacco chitinase gene
RL  Plant Mol. Biol. 39:1051-1062 (1999)
RN  [2]
RX  MEDLINE; 20544092 PubMed; 11094983
RA  Fukuda, Y.
RT  Interaction of nuclear proteins with intrinsically curved
RT  DNA in a matrix attachment region of a tobacco gene
RL  Plant Mol. Biol. 44:91-98 (2000)
//