S/MARt DB - S/MAR

AC  SM0000214
XX
DT  23.11.1999 13:55:58 (created); ili
DT  23.11.1999 14:43:01 (updated); ili
XX
NA  HS$SPRR2A-MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2195 bp
XX
LO  1q21
DE  G001543; small proline-rich protein 2A
DP  Direction: 5'; 2214 - 20; Pos 1: ATG
DN  Internal: y; Gene position numeral: 0
DC  overlaps minimal promoter, coincides with first exon and
DC  first intron [1]
XX
SQ  AAGCTTCCTTGGAATTAATGGTCAGATAAGGAGCTCTAGCAATATCACTTTAAATGCTTA
SQ  ATATACAATATTTAGAAAACCTTATGATTGTAAAGAGCTTAAAAAAGATGTGAAAGAACA
SQ  ATCACTAAARGCATTGACAACATATGTGTGTTAGTGAACAATATGTACCAAAATGGACAG
SQ  ATGAGAGGTGTACATTGGGGTGTGAGTTGATAATCCAGCAGACTGTGGGACTAGAGGGTC
SQ  TACGAAAAACAAAGGAAGAACATACAAACAAATTTTAAAACACTGTCTTTCAACACTAAA
SQ  ACTGTTGGAATAGAGAGCAAGAATACATATTGGATTCACATTCAGTTTATTTCTCAGATT
SQ  CAGACTAGTGCTCTGACTCTGCACTCTGCAACCTACTCTAATATTACATATGATAACATG
SQ  AGTCTATGCAGCTGTTCTCTATAGATATTCACAGACACTACAGAATGTTTTGGAGATTAT
SQ  GTAATATTTAAAATATTCAAATTATACTAAAAATGTATGTAAAATGTATTGAACATAGGC
SQ  AAGTTTCAATACATAGATTTTGAGTGAATGCTTGCAACTTTGGTTCCATTCTCTCTACTT
SQ  CCTTAAGGTGGTGTCCAAGAGTACATTTTTATAAATAAAAAGTTATAGTACACTCCTAAG
SQ  GGCAGCAAGTAGAAAACGTGCTAGGGAGACTCGATCTCACTTTGGAATCTATCCTGGGAG
SQ  ACAAATGCCTCTACAAATGGATTAGAGAAGACAGTTTTAAAGAGGAAGATAATCAGGTAA
SQ  AATCTGGGGTTTTATGAGAGAAAGAAAGAGGTAGAAGAAAAAATTTCAAGCTCGAACATC
SQ  GGATCAGGTGGCACAATGCGGTCAATGCCTGCAAACTCAGGGTAAGTATTATTCTCCCTG
SQ  TTTACAGTTCCGTGGAGGAGAAGTGACTTGCCTGTGGTCATACAACAGAGCAAAGAAAAG
SQ  GCTTGAGCTAGAACTCAGGCCTTTGTTAGGTCTCCCCTTCCTCCTAGCACATTGGCAAAT
SQ  TGCATGAGGAAAGTAGAGGTACAGTTGAGTTCATGTACAACAATAAGGCATTCAGGTAAA
SQ  GTGAATGAGGGCAGAAGTTTTATGATTTAGGGAAGGTGTAAGACAGGAAAATATCTTTGT
SQ  TCCCAATTAAGAAAGAGATCCCTTGACCATCAGTTAGAGATTCCCCCAAGTCCCTCTTTG
SQ  CCATAAGTCACTGAAACTGAGATCCAAGGCATGGCTTCTGTGAGTCAGGAGAGCTTAACC
SQ  CAGAGGAGAGATTTCAGAACAGGATATTTCCTATTTTGAGTATCCTGCTCATGCCAGTCA
SQ  TGGATAAATTTGCATCTGGCTTAAGAAATTACTGGATCAGCATTGTTTTGGGTAGTTTCA
SQ  CTTCCTGCTGGGTGGGGTAGCAGGCTCTATAAAGAGATCCTCTGCTGCACGACTCTTAAA
SQ  CCCCTGGTACCTGAGCACTGATCTGCCTTGGAGAACCTGGTGAGTCGGCTTCCTTGAGTT
SQ  CCTCTGTTCTTTGTGCCCTGAAATGTTGAGTTTAATCTGAATATGGCAAGTTTGGTGGAT
SQ  CCAATCCTATGAAAATTGACTTGATGCTACTTAGTGGATGAAAATTTAAGATTAGAGCAC
SQ  AATTATATGCTATTTTAGCTTTCTTTTGTTATACAGGTAGGTATCCATATGGACAGAGAA
SQ  GTTAAGGGGTAACCTTTGATATGAAGAAGAAAAAAGAACAAAGTATTTTTCTTTATTCTC
SQ  TTGCTTTCTAGTGTCCTTTACAAAGGTTTGTGTCTTAGCAGGTGTGAAAGACTACAATTC
SQ  TCCCTGAGCAGCCCTTTGCTCTATGCCCAAGTCAGCCCACTTGGACTTTATAACAGATAA
SQ  TGATGATAGGAATAGCATATTAGATTGCCCAGGGTGTCTGAACTTGTGACTGCCTTTCTT
SQ  GAATTGGTTATTTTCAGGGAAATAAGATGCTTGATTCTTTATAACAGAGATAATTTATTT
SQ  GGAAAAATTGTATGAGAAAACACAGGATTTCCTAGGGACAATGAAGCAATTTGTTAAAGT
SQ  GGAAGGGAGAAACCAGAAAGTCTTGAAAAGGTAATTAAGAATTTAAATAATTTCTTGGAG
SQ  ATTGGAGAAATAATATGCCATGGTATTACACAAGCTTTGGCTTCTCTCTCTGGAGGATTC
SQ  CCTTCCCACGAACACTGTTGTATCATTTCTTTCAGA
SC  EMBL #X53064; nt 1-2195, release 57
XX
FT  1304 - 1451(EMBL): minimal promoter [1]
FT  1438 - 1479(EMBL): exon 1
FT  1480 - 2195(EMBL): intron 1
XX
FF  strength comparable to HPRT-MAR [1]; stimulatory effect
FF  on transcription observed in transient transfection [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection of S/MAR [1]
XX
DR  EMBL: X53064; HSX53064
XX
RN  [1]
RX  MEDLINE; 99045591 PubMed; 9826750
RA  Fischer, D. F., van Drunen, C. M., Winkler, G. S., van de
RA  Putte,  P., Backendorf, C.
RT  Involvement of a nuclear matrix association region in the
RT  regulation of the SPRR2A keratinocyte terminal
RT  differentiation marker
RL  Nucleic Acids Res. 26:5288-5294 (1998)
//