S/MARt DB - S/MAR

AC  SM0000216
XX
DT  30.11.1999 12:00:29 (created); ili
DT  13.12.1999 15:49:30 (updated); ili
XX
NA  HS$r21-MAR1
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  2716 bp
XX
LO  r(21)
XX
SQ  GAATTCAGGAATATAATGCATCATTCAGTAACTTCAGTAATCCCCATCCTGGGGGAGCCA
SQ  CAGAACGGGGGTGAGAAATCACAGAATTACGACAAGGTGTCTGGGAACTCAGGTGTCCAA
SQ  CAAGCATTGTCTGAAATCTGAACAAATCTGATTGACTGTTTTGCAATAAATATGTAGGTG
SQ  CTATTAAGGCTAGCAAAACCCCAATTGCCTTAAAAGGGTCAATAATTTATTTATAACACC
SQ  TATTTGACAATAGTTATTTTCTCAACCAACAAATACCAACCTATCCCATGAGTCTTCAAG
SQ  ATGTGTTGACATTACAAAGGACCCTCATTCCAAAACACTGGGAACCCCTGATCCAAGCAG
SQ  TCTGTGTCCTGGGAGGTGAAGATATGGGGGTCACCTCAGCAGGGCCTGGGGAAAGGCTCT
SQ  TTGAGGGGAGGGGCTTCTCACCTGCTTTTGTACAGGCAGTGGGGTGGCAGTGGGACTTAG
SQ  GTAAGTGGGCAGTGAGTGGGCAGGGCAATTCCCCAAAGGGAAGAGACTGCGGAGGTGTGG
SQ  GGGAAGAAACAGTCTGCCCTCAGCTTTTGTTGCGTCCTCCCTGCACTTTCTTACTAGCAG
SQ  CTGGAGGTCAGAAAAGGCATTCACCAGCAATTTTGCTTCCCTAACATCTTTTATATTGAA
SQ  GTCACTCTGACTTAGAGAGCATCCTACATTTTAGTCACTGACCCATAAAGTACAAATGAA
SQ  AGCTGGTAAAAGGATAACAATCAGCATTCTGAATAACTCGCTGGGAAATGCCTCAAACTT
SQ  GAAGGATGTTTTAATAATAATTCACCAATCAATTCCATTAGTCTTAAAGATGAGACAAGT
SQ  ACAAAGAGAAAATTTGAATTACACAGCTCCTCTTGCTACAATTTAAAGCTATTTTGAGCT
SQ  AAGTTTAAACCTTTTGAAATGTAGTATCTTGCTGTCTTTCAGCCAGAAAAATGCAAGATA
SQ  CTAATAGTAAAACCCAATTAATAATAAACTATATTTCTGTGCTTCACATTTTTGCTCAAG
SQ  TGATATGCCCTTTATATCTCAATGCCATATTTTAACAGCTCTCTTTATTCAAAAAACCAT
SQ  GCCAAGCAAAGGTAATTTAAACTGCTTTTATCATGCAACCTTAACACCTAGGTTTTTAAA
SQ  AATAAGGATTTCTTAAAAAGTTTTTCATCCACTGTAGCCTTTTTTTAGTCACTATCTCTC
SQ  TTAACATACTTATTTGTTCTACTCGTGCTTTACCTAATCCTAGCATGCTCTGCTAATGAA
SQ  TTTATTTGTTTCTGATCACTTTTTCAAATGACAGTTTTGTTTTTTTGTTTGGGGGATTTT
SQ  GTTTGGGGTTTTTTGCATATATATTAATTTCCTGAGGCTGCCATATTAAACTGTCATATC
SQ  AAACATATTCTATACCACAAACTTGGAGGCTTAAACAACGGAAATTTATGGCCTAACAGC
SQ  TCTGGAGGTCAGAAGTCCAAGATGAAGGGTCAGCCAGGTTGGTTCTTCTGAGGACTGTGA
SQ  GGGGAAATCTGTTCCTTGCCTCTGCCTTAGCTTCTGGTGGTTTGCAGGCAACCTGACATT
SQ  CCTTGGTTTGTAGCTGTATCATCTCCATCTCTGCCTTCATCTTCCCATGGCATTCTTCCT
SQ  GTGTGTATGTCTTTGTCCAAATTTCTCCTTTTTGTAAAGGCAACAGTCATCTTGGATTAG
SQ  GGGCCCACCCTACTCCAGTATGACTTTATCTTAACTAACTACATCTGCAATGAACCTATT
SQ  TCCAAATAAGGTTACATTCTGAGGTCCTAGAGGTTAGAACTCCAACATATGAATTTCAGA
SQ  GTGAAGGAGGAACATGATTCAACGCATAACAGCTTGTAACATTGTGTACAGAAGGTGCAA
SQ  CTTTTTTTTTTTATTCTACTTCAAGTTTTAGGGTACATGTGCACATTGTGCAGGTTAGTT
SQ  ACATATGTATACATGTGCCATGCTGGTACGCTGCACCCACTAACTCGTCATCTAGCATTA
SQ  GGTATATCTCCCAATGCTATCCCTCCCCCCTCCCCCCACCCCTCAGAGAACTGCAAATCA
SQ  AAACCACTATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAA
SQ  ACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACT
SQ  GTAAACTAGTTCAACCATTGTGGAAGACAGTGTGGCAATTCCTCAAGGATCTAGAACTAG
SQ  AAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAATGACTATAAATCAT
SQ  GCTGCTATAAAGACACANGCACACATGTTTATTGCGGCATTATTNACAANANGCAAAGAC
SQ  TTGGGACCAANCCCNAAATGTCCAACAATGATAGACTGGATTAAGAAAAATGTGGCACAT
SQ  ATACACCATGGAATACTATTGCAGCCATAAAAAATGATGGGTTCATGTCCTTTGTAGGGA
SQ  CATGGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAAC
SQ  GCCGCATATTCTCACTCATAGGTGGGAATTGAACAATGAGATCACATGGACACAGGAAGG
SQ  GGAATATCACACTCTGAAGGTGCAACTTTTAAATGCTGTGTTTGAATGGTTTCCTACTTA
SQ  TTGACGGACCCATCATGTATACGAATTAAGGTTTAGGATCTTGTAACCAAGCCTTCTTGA
SQ  GATTCTNCTTGCCATT
SC  EMBL #M22486
XX
FT  168 - 173: ATATTT- motif [2]
FT  230 - 235: ATATTT- motif [2]
FT  618 - 626: insertion at ring/recombination junction [2]
FT  650 - 655: ATATTT- motif [2]
FT  991 - 996: ATATTT- motif [2]
FT  1031 - 1036: ATATTT- motif [2]
FT  1047 - 1052: ATATTT- motif [2]
XX
SF  LINE element [1]; sequence may be in complete as judged
SF  by [1]; caution: sequence is annotated as distal long
SF  arm DNA in EMBL
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: M22486; HSC21DLA
XX
RN  [1]
RX  MEDLINE; 89315824 PubMed; 2546156
RA  Sperry, A. O., Blasquez, V. C., Garrard, W. T.
RT  Dysfunction of chromosomal llop attachment sites:
RT  Illegitimate recombination linked to matrix association
RT  regions and topoisomerase II
RL  Proc. Natl. Acad. Sci. USA 86:5497-5501 (1989)
RN  [2]
RX  MEDLINE; 89184537 PubMed; 2648387
RA  Wong, C., Kazazian jr, H. H., Stetten, G., Earnshaw, W. C.,
RA  van Keuren, M. L., Antonarakis, S. E.
RT  Molecular mechanism in the formation of a human ring
RT  chromosome 21
RL  Proc. Natl. Acad. Sci. USA 86:1914-1918 (1989)
//