S/MARt DB - S/MAR

AC  SM0000217
XX
DT  30.11.1999 17:48:21 (created); ili
DT  27.2.2002 16:38:00 (updated); ili
XX
NA  HS$alpha1AT-5MAR
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1274 bp
XX
LO  14q32.1
DE  G000199; alpha1-antitrypsin
DP  Direction: 5'; 17000 - 15000; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DE  G001403; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2
DP  Direction: 5'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 2

G000199;
alpha1-antitrypsin
G001403;
serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2

XX
SQ  GAATTCTATGCATATTGGCTTAGATAAGTGAGTGCTTATATAAATTGTTAAAATATGGTA
SQ  ATTAACTCAAATGTCTTTCAGTTCATGTGACTTAAGTAAATATTTAATAAATAAGCTGTG
SQ  TTTAAATTTGTTGATAAAATAAACATGTATTCATAGTTTTCAGCATAGTTTCTTGCCTGA
SQ  GTTTACTGGTCAGACAAGATTATATTTGTCTTTGCTAGATGCTTTAAAGTCATAAAACTA
SQ  TAAACTCAGCCTAAAATCAAAATGATCTTTGTGAAACTCTTTGATAAGTAGACTAATTTA
SQ  ATATTGTTTGTTTAATAAAAACAGCTGTATCTTCTGAGTTATTGGCAAATACCCAAGTAT
SQ  TTAGGGTTCTTATGTAGGTGAATATCTGATATTCACAAGTTATAAAAATTGTTATTAAGG
SQ  AAATAACTTGAAATGCTGACTAACTTTGTCTAATAGTTTAGTTTTTAAAAGTAATCTAGG
SQ  TATAATTGTTAAATAAATAAATAAATGAAAAAGGTGAATGTAAATGGAATAAATGATTAT
SQ  AAATGAACTTTTTATGTAATTTAAAATCTTGAAGTTATATTATATTTAATTAAGCAATAG
SQ  ATACTTATCAGATGTTCAGGTCATTTCCAAATAAAATAAAATACTGAAACATAAATTAGT
SQ  GAACATCAATGTAAGTTTGTTCTTGGCTTCTTAAATTTTATATAAAGACTAAAATATATT
SQ  TGGGTCTTTTAGTACACATAAAAATTATGTTATGGGGAAACATGTTTCTAAAATTATAAA
SQ  ATGGTTCTTATCTGTAAAATACTGATACATCACAGTTAAAAATTTCTTGCTTCTCATATT
SQ  TTCACTAGAAATTTAGGCTACTGAGAGTTAACAATTCTAATTAATACATATAATTCTGTA
SQ  TAACGAGTGTACTAAAAGATGTATTTATGATGAAAATATAAGAAAGACATTAAAATAAAC
SQ  TCTTTATTGAGAAAAAGAATAATTGTGTCTAAGTTCAGAGGCTATTTAAGGTTTTTTAAA
SQ  AAAATAAATTTGGAAAAGAAAGACAAGATAGAAAAAAGCAGTAAGTAGGAAAGAAAGATG
SQ  TGAAGGAAGTTATAAGTCATACATATGTATTTTTGGTAAGGAAGTTTAAAAAAATTATTT
SQ  TTCAAATAATAATAAAAAGGAAAGTACATTTTTGTCCTAAAGTAACATGACTGTTTAAGA
SQ  AAGGAAGAAACAAAGGTCTAAGTATATAATGAAAGGTCTGAGTAAGTTGTAAAAGGTTTA
SQ  TGAAAAATGAATTC
SC  EMBL #AF156542
XX
FT  2 - 205: repeat (LTR/retroviral)
FT  13 - 248: repeat (LTR/MER4-group)
FT  358 - 559: repeat (LTR/MER4-group)
FT  644 - 1270: repeat (LTR/MER4-group)
XX
SF  multiple putative SATB1 binding sites [1]; motifs with
SF  similarity to the Drosophila topoisomerase II consensus
SF  [1]; DNA unwinding motifs, A- and T-box motifs [1]
XX
TP  concluded to be permanently attached [1]
XX
CP  HeLa S3 and HepG2 [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AF156542; AF156542
XX
RN  [1]
RX  MEDLINE; 99412420 PubMed; 10481016
RA  Rollini, P., Namciu, S. J., Marsden, M. D., Fournier, R. E.
RA  K.
RT  Identification and characterization of nuclear matrix-
RT  attachment regions in the human serpin gene cluster at
RT  14q32.1
RL  Nucleic Acids Res. 27:3779-3791 (1999)
//