S/MARt DB - S/MAR

AC  SM0000218
XX
DT  30.11.1999 18:38:15 (created); ili
DT  27.2.2002 16:48:00 (updated); ili
XX
NA  HS$CBG-5MAR2
XX
SY  CBG 5'MAR, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  8419 bp
XX
LO  14q32.1
DE  G000199; alpha1-antitrypsin
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DE  G001403; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; Gene position numeral: -1
DE  G001547; corticosteroid-binding globulin
DP  Direction: 5'; 17000 - 9000; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  one of 3 S/MARs between ATR and CBG genes, this is the
DC  middle one [1]

G000199;
alpha1-antitrypsin
G001403;
serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2
G001547;
corticosteroid-binding globulin

XX
SQ  TCTAGAAATATTCTCATCGCTTGGCTTCCAGGACACACACACTCTCCTGGTCATCTTGTG
SQ  CTCTCCTGTGCCCAGCTGGCTGCTGCTTCTCAGCGTCCTATCCTGGCTCTGCCTCACCTC
SQ  CCCAACTCTTTAACTTTTGAATGTCCCAGGACTCAGTCCTTGAGCCATTTTTCTTTTCCA
SQ  TCTACACTCAGTCCCTAGGTGATCTCATCTGGTCTCATGGATCTTAAAAGCCATCTAAAA
SQ  CCTGATGCTCCTAAATTTGTATCTCTAGCACAAATGTCACCTTTGAACTCCAGACTCATA
SQ  CATCCAACTGCATACTGGCCATCTGATAGCCATCTCAAACATAACATATTTACAACTGAG
SQ  CTCCTGATCCCTACAGCCAAACTGGCTCCACTTTCAGTCTTCTCATTTTAGTTAATAGGT
SQ  AACAGTAATGTCATCCTTCCAATTGCTTGGGTTCATACCTTTGGAGTCATCCTTGACCTG
SQ  TCATTTTTTTCTTACACCACACATTGCATCTGTCAGCAAACACTGTCAGCAAATACCATC
SQ  AGCCCTACCTCTAAAATATATCTAAAATCCAACTACTTCTCACCATGTCCACTGCTACCC
SQ  TCTTGTCCAAGCTACTATTAAGTTTCTCCTCAACTATTGCGACAGTGGCCTAAACTAACT
SQ  CCCTAAATGTAGAGGTGAAAGGAGAGACAGAAAATATGGGAATATACTGACCCAATAATG
SQ  CTATCTAAGGAACTAGAGGATGATTAAATGTAGCGTATATAATTATAAGGAAGAAACTCA
SQ  TATATTAATAATGCTCAATAATTTTTCAAAAAAGATCCCAAGAAAATGCAACAGCATGGT
SQ  CTTTTCAACGTATTGGCCTAGGACAATTGGATATCTATATGCAACAAAAAGAAAGAACAT
SQ  ATGCCCCACTTTCTTATACTGTCACAAAAATTAACTTAAAATGAACCAGACTTAGATGTA
SQ  AAAGCTAAAACAATAAAAGTTCTACAATAAACCATAGGAGAAACATTTTATGACCTCAGG
SQ  TTAGGTAAGGCATTCCTATATATGACACCAAAAGCATGATCAATAAAAGAAAAAAGATGG
SQ  TAAATTGGCCTTTACTAAAGCAAATGTTTATACTTCAAAAGATGCTACTAGGAAAATTAA
SQ  AAGTCCAGCCACAAGTTTCTTACAAACTGAAACACAGTCTTATCACAAGATGCAGCAATC
SQ  ATTATCTCAGATATTTACTCAACCAATTAGAAAGCTTTCTCCACACAAGAACCTGTACCC
SQ  AAGGGTTTATAGTTCATAATCGTTAAAAACTGTGAGCAAGCCAGGCACAGTTGGCTCACA
SQ  TCTGTAATCACARCACTTTGGGAGGCTGAGGTGGGCGGATCACTTGAGGTCAGGAGTTCG
SQ  AGACGAGCCTGGTCAACATGGTGACACCCCTTCTCTACTAAAAATACAAAAAATAATAAT
SQ  TAGCCAGGCATGGTGGCACATGCCTGTAATCCCAGCTACTAGGGAGGCTGAGGCAGGAGA
SQ  ATTGCTAGAACCTGGGAGGTGGAGATTGGAGTGAGCCAAGATTGCACTACTGCACTCCAG
SQ  CCTGGGAACAGAGTGAGGCTCTGTCTCAAAATAAATAAATAAAAAACTGTGAGCAACCAA
SQ  GATGTCCTTCAATAGATTAATAAAGTTTGGTATATGCAAACAATAAAATTTCATGATAAA
SQ  GATAAAGAGATAAAGTAATAAAAATAAAGGAGCTGTCAAAAATAAATGAGCTGTCAAATC
SQ  TTAAAGAGACATGGAGAGACCTTAAGTGCATATTTCTAAGTGAAATAAGTCAATCTGCAT
SQ  ACTGAAAGAAGTCAGGCTACATATTATATGACTTCAATTATAAGATATTCTGGAAAAGGC
SQ  AAAACTGTAGCAACAGTAAAAAGACCAGTAGTTGCCAGGAGTTCAGGGGAAGGAGTGAAG
SQ  GGTAAAATAGTTGAAACACAGGCTATTTTTTAGGGTGATGAAACTATTTTGTACAGTGCT
SQ  ATAATGGCACACACATGACACTACACATTTGTCAAAGCCCATAGAACTTTACAACACAAA
SQ  ATATGAACCTGCAAATTAAGGAATACTCATCAAAGAGTTGGAGGATCTCAGGATAAAAAG
SQ  TAGAATATGACCAAACAATCTAATTGTATTAGAAATACATGAAACAACTTCACTGACAGG
SQ  ATAGGGGTTGCTGACGTGAGTAACTTTAGAAATGACTGGAGAAAGAGTAAAGGAAAAATA
SQ  AATTGCATGTAAGCATGGTGCTCTAGTTAGAAAAGTTGTTTCCCACAGGGGTACAAGTTA
SQ  ACAATTCTGATACCAATATGCATGTATACAGGAATTAAACAATTAGCCAAATGAAGTAAA
SQ  TGGAAGGTGGGTGGTGGGAGCCAGGTTGGGGCGGGAGGTGACAGATAAGTAAGAGGAAAC
SQ  TGAGATGGTCTATGACTTAGAGTTGGAGATATTAGTATAAACTCGTGATTTGCTATTTAA
SQ  TCTAGAGATAGATGGTTATACGTATAAATGCTAAGATATGTGTATAGGCACTGGTTTGTG
SQ  TATATACATATATTCCCTTACTCTGTGATATGGTTTGGCTGTGTCCCCACCTAAAATCTC
SQ  ATCTTAAATTGTAATCCCCACATGTCAAGGTGGAGGTAATTGGATCATCAGGGCAATTTC
SQ  CCCCATGCTGTTCTCATGATAGTGAGTGAGTCTCACGAGATCTGATGGTTTTATTAGTCT
SQ  TTGGCATTTCCCCTGCTGGCACTCATTCTCTCCCCTGCCTCCCTGTGAAGAGGTGCTTTC
SQ  CAACATGATTGTAAGTTTCCTGAGGCCTCCCCAGCCATGCGGAACTGTGAGTCAATTAAA
SQ  TCTCTTTTCTTTATAAATTACCCAGACTCGGGTATTTATTCATAGCCATGTGAGAATGGA
SQ  ATAATACACTCTGTCAGCTGAGAGGGTCTAGAAGCAATGATACTTCAGCAGCAGTGAGCA
SQ  CACAGAGCAACAGGATCTTGGTTTCTAACACCATTCTTCAGTAGAAGTAACCAGGCCTCC
SQ  TTGAAGAAATGACTGAGTCTAGGACTGGGGCAAGAAATACACAAAATGATGCTGGAGCAT
SQ  CTTGTATTGCCAGGAAATAAGGAAGTGTTTTAAAAACCATCACAGTGCTGGGAGTATGTC
SQ  AGTGGAACACAGGAGTCAACTGAAAGAGCTCCCAATGATCCAAGTTGGGTCAATTTGAAC
SQ  AAAAAATAAGTGAAGTAGTATTATAGATTATAACAGTGTGCATATATAATAGGCTACAAC
SQ  TCAAGAGTATAAAATAAATATTTATGAGTCCATACTATTATAAATAAATTATTGAATAAA
SQ  TTAATAAATTGGAAAGAAGAGATAAATCTGCAATGCAGAATAATTTCAAATACACTATGT
SQ  AAATAGCCTCAAGGAGGTAGAGCTTAATTCCTTTCACCTTAAGTGTGGGCTACACATAGT
SQ  GACTCCTTCCAAGAAGGGCAGTGTATAAAAGAGTAACTTTATGGTGAAGAAATTGGATAA
SQ  ACACGACAAACAGGTGATCAAGGTCAACATCGACAGTGATAAGTCATGTTGATAGTATGT
SQ  ACTCTTGATGTGATGTGATCAAAATGGCACTTTATATCTGTGGTCTTCCTCTGAAAAACC
SQ  CATAACCCCAATATAGTCATGAAAAACATCAGACAAGTTTCACTAGAGGGCAGTTTACAA
SQ  AATATTTGACCAGTAGGCCTCAAAACTGGCGAGGTCATCAAAACCACGGAAAGAAACTGT
SQ  CACAGCCAAGAGAAGCCTAAGGAAACATGATGACTACGTGTTCCGTGGTATCCTGGATGT
SQ  GATCCCAGAATAAAAAAGGACATTTGGTAAGAAAGATTCACATTGAAATATTAATAAAGT
SQ  ATAGACTTTAGATAATGATAATGTATCAATATTGGTTTATTAATTACAATGAACATATGT
SQ  AAATATAAGTTGTCAATAATATGGAAAACTGGGTATGGGGTATATAGGACCTCTCTATAA
SQ  TATCTTTGCAATTTTTCTGTCAATCTAAAACTTCTAAAATAAAAAAAATTTAAGGCAAGC
SQ  TACAGATAGGAAAAAAAATGTTAGCAAATCATATCACTGATAAAGAACTTGTATCCAAAA
SQ  TATATAAAGAACTCTTATAACTCAGTAATAAAACAAATGACTTAACCCAATTTAAAAATG
SQ  ACAAATGACTTGAATAGACATTCACCAAAGAAGACATATGGATGGCTAATAAACACATGA
SQ  AAAGGCACTCTATTTGGTCAGTAGGAAAATGCAAATTAAAACTATAATGAGCTACAACCA
SQ  CACAACCACTAGTATGTCTAAAATAAAAAAACAGAAAATATCAAGTGTTTATTAAGATGG
SQ  TGAACTTAGAACTCTCACACATTGCTGGTGAGATTATAAAATGGTGCTGTCACTTTGTAA
SQ  AATAATTTGGCACTTTCATAAAATGTCAAATGTGAACATATGACTCAACAATTCTACAAA
SQ  GAGAAATGAAAACATAAGTCTATACAAAAAGAGACTTGCACATGAACACAAGTCTATATG
SQ  AACAAAATGAATTCTAAATGGATAAATAAATATATGAATACAATACTATATGAATAATAT
SQ  CAATTCACATATGAATAATAGCCTCAAACTGGAAACAATCTAAATATTTATCAACTGGTG
SQ  AATTGATTAATAAAATTTTACACAATGGAATACTATTCAGCAATAAAAAGGAATGAGCTA
SQ  ATGATCTTACTATAGTTAACCCTTGAATAAAGCACGTTTGACTTTCTCCCTCCTCTGCCA
SQ  ATCCTGAGATGGCAAGACCAACCCCTCCTCTTTCTCCTCCTCCTCAGCCTACTCAACATG
SQ  AACACAAGGAGGGTGAAAACATTTATGATTATCTATTTCCACTTAATAAACAGAAAATAT
SQ  ATTTTCTCTTCCTTATGATTTTTTAAATAACATGTTCTTTTCTCTAGCTTACCTTATTGT
SQ  AAGCATATGCTATATAATGCTATAACAACAAAATGCATATTAATTGACTATTTACGTTAT
SQ  AAGTAAGGCTTCCGGTCAACAGTAGGCTATTAGTAGTTAAGTTTTGGGGAGTCAAAAGTT
SQ  ATTTGTGAATCTTCAACTGCATGGAGGATTGGTTCCCCTAACCCCCATGTTGTTCAAGGG
SQ  CCACGTGTAGAATGTGGTTGCATCTTGAAAATGTCGTGCTAAGTGAAAAAAGCTAGACCC
SQ  ATAATGCTACCTATGAGTCCACTTATGTAAATTATCCAGAAGAGGCAAATGTGTAGAGCC
SQ  AGAAAGTGGATCAGTGGTGGCCTAGGGTTATAGCTGGTCCACTTTCTGGCTCTACACATT
SQ  TGAGAGGGTCAATTGACAGCAAAAGGGTTCCTGCAGATCTTTGTGGTGACAGATAGGTTC
SQ  TAAACCTGGATTCTGGTGAAAATGGCACAAGTCTATGACTTAAGTAAAAATCATTGGATT
SQ  AGACACTGACAATGAGTGAGTTTTATGGTATATAAATTATATCACAATAAAGCTGTTAAA
SQ  AATCTTTGGAGACACATCTAGCACTATGTTTAGGAGGAAATTTTACTGCTTCTAAGACAT
SQ  ATATTTTCCTATAAAGGAAAAAATATCCACGAGGTAATCATCTCAAGAAATTAGAAAAAG
SQ  AAGCACAAATGAAACAAAACAACGTAGAAAAAAGGAAATAAGCAGAACAAAAATTAATGA
SQ  AATAGAAAGCAAACATAAAATTAGACAAATCAAGAACTCCAAAAGTCGGTTCTTTGAATA
SQ  TGCCATAATTTTAACGATTGATTTAAAAAAAAAATGAAGCACAAATAAGCTAGGCCAGGA
SQ  ATGAAAAATGGACCATTTACTGTAGATCTGAAACATGCTAAAGAGGTAATTAGAAGATAG
SQ  TATGAAAACTTTGTATAAGTAAGCTTTAGAAATTAGATTAAATGGGCAAATTTCAAAAAA
SQ  AAATTAAAGAAATAGAAAATCTGAATAGTTCTCTAACTATGAAAGAAATTAAATCCATAA
SQ  ATAAAAATCTCTCTCAAAGAAAATTCTAAGCCCAGATGGTTTCTCTGGCAAATTCTACCA
SQ  CACATCTAAGGAAAAACTGACGTTAAGCTTACACATTTTTCCAGGCCTTAGAATAACACG
SQ  CCTCAACTTGTTTAATGAGGTCAGCATGACATTGACAACCAGAGCTGGCAAGAGCACAAG
SQ  GAAAAAGGAAAATTACTGACCACTGTGTGTACTGAAAACACTACATCAACTGTTTACACT
SQ  CATCACCGTGACACTCTTAGATGGGTAATATTCTTTGCTTCATTTAATGTATCAGAAAAT
SQ  TGGGGTTGGGGGAGCATATGAAATTGGACAAAGTCACATAATTAGTAATTCATTATAGTA
SQ  GTATAGAAAGCAGATGTGACCGACTACAAAGGTCTGCATAGGTTTTCTCTTTAGTTTTTC
SQ  AATCTAACCTTCCTCCTCAGGGAAGCTAGGAAGACAAGAAGCTGAGTCTCATATAGAAAA
SQ  AGGAAGAAGCTAAATCGTCTCTGTTTGCTGACAGCATGCTCTTACATATAGAAAAGCCTG
SQ  GACTCCACCAAAAAGCTGTTAGAACTAATGAACAAATTTGAGAAAATTGCAGAATATAAA
SQ  ATCAACATACAAAAATCAGTAGCATTTTTATACACTAACAACAAATTATCAAAAAAAGAA
SQ  ATCAAGAAAACAATGGCATTGACAATAGTTACAAAAAAATAAAATGCTCAGGAATACATT
SQ  TAACCAAGGAGGTGAAAGACCTGTACGTTGAAAACTATAAAACATTAATGAAAGAAATTG
SQ  AAGAGGGGACAAATAAACGGAAAGGTAACCTGTGTTCATGGATTGAAAGAAATAATATTG
SQ  TTAAAATGGCCACACTACTCAAAGCAATCTACAGAGTCAATGCGATCCCTATCAAAGTTC
SQ  CAGCATTTTTCACAGAAATAGAAAAAACAACCCTAAAATTCATATGGAACCACAAAAGAT
SQ  CTTGAATAGCCAAGGCAATTGAGCAAAAAGAACAAAGCTGGAGGTATTATCCTCTTGATT
SQ  GAAAATATATTACAAAGCTATAGTAATCAAAACAGCAGTATTGGCTAATAGAAACAGACT
SQ  CATAAACCAATGGAAAAGCATAGAGGCCAGTAACTAACCCATGTGATTATGGTCAATTGA
SQ  TTTCAACAAAAGTATCAAGAGCACACACCAGGCAAAGAACAGTTTCTTCAACAAATAGTG
SQ  CTGGGGAAACTGAATATCCACGTGCAGAAGAATGAAATTGGACCTTTATTTCACACCATA
SQ  CAAAAAAAAATTCAAAATAGATTCAAGGCTTAAATATAAGACCTGAGACTGCAAAACTAC
SQ  TAGAAAAAAATTAAGTGAAAACTACATGACATTGGTCTGGGCAACAAATTTTTGGATTTG
SQ  ACCCTGAAAGCGCAAGCTACAAAAGCAAAAATAGACTAATGAGATTGCATCAAATTAAAA
SQ  ATCTTCTGTACAGCAAAGGAAACAATTAACAGAGTGAAGAGACAGACTACAGATTGGAAG
SQ  AAAATATTTAGAAGCCATGCATCTGATAAGGGGTTAATATCCACATTATATAAGTAACTT
SQ  AATAGCAAAAAAAAAACTTTGATTTTTAAAAATGGACAAAGGATCTGAATAGGCATTTCT
SQ  CACAAGACATAAAAATGGCCAACAGATATGTGAATAAATGTTCAACATTACTAATGATTA
SQ  GTAAATGCTAATTAAAATCACAATAAGATATCACCTCCCACCTGTCAAAATGGCTATCAT
SQ  CAAAAAGCCAAAAGATAAGCATTGGTGAGGATGTGGGAAAAGGAAATCTTTGTACACTGT
SQ  TGGTAGGATTGTAAATTAGTACAGCCACTATAGAAAACAGTGTGGAGTTTCCTCAAAAAA
SQ  ATAAAAACAGAACAACCATATGATCCAGCAATCCCACTTCTGGGTATCTATCCAAAGGAA
SQ  ATGAAATCAATATGTCAAAGAGATACCTTCCCTTTCATGTTCATTGCAGCATTGTTCACA
SQ  ATAGCCAAGATACAGAATCAATCTATTCATCCATTAACAAATGAATAAAGAAAATCTGGT
SQ  GTGTGTGTGTGTGTGTGTTCTCTCTGTTTGCTGATGGCATGATCTTATATGTAAAAAAGC
SQ  CTAGACTCCACCAAAAAACTATAAGAAGTAATAAACAAATTTGGTAAAACTGCAGAATAT
SQ  TAAATCAACATACAAAAATCAGTAGCATTTCTATACACATACACAAACAAACACAATGGA
SQ  ATAATATTCAGCCTTTAAAAGAAAGAAAATTCTATTATTTGGGACAACATGGATGAACAT
SQ  TATGCTAAGTGAAATAAGCCAGACTCAGTCAGAAAGACAAATACTTCAGGATCTCACTTA
SQ  CATGTGGACTCTATAACAATTGAACTCATGGAAAAAGAGAGTAGAATGATAGCTACAAGA
SQ  GGCAGGCAAGTGGAGGAGATGGGGAGGTGTTTGTCAAAGGGTACAAAGTATCAGTTAGAC
SQ  AGGAGGAATAAGTTTTTCA
SC  EMBL #AF156545; nt 22043-30461, release 61
XX
FT  22810 - 23195(EMBL): repeat (LINE/L1)
FT  23196 - 23340(EMBL): repeat (LINE/L1)
FT  23341 - 23648(EMBL): repeat (SINE/Alu)
FT  23649 - 24493(EMBL): repeat (LINE/L1)
FT  24588 - 24930(EMBL): repeat (LTR/MaLR)
FT  24932 - 26046(EMBL): repeat (LINE/L1)
FT  26054 - 26528(EMBL): repeat (LINE/L1)
FT  26617 - 26736(EMBL): repeat (LINE/L1)
FT  26767 - 27145(EMBL): repeat (DNA/MER2-type)
FT  27150 - 27498(EMBL): repeat (LINE/L1)
FT  27474 - 28184(EMBL): repeat (LINE/L1)
FT  28222 - 28330(EMBL): repeat (SINE/MIR)
FT  28461 - 30020(EMBL): repeat (LINE/L1)
FT  30021 - 30040(EMBL): TG stretch (20/20)
FT  30043 - 30192(EMBL): repeat (LINE/L1)
FT  30193 - 30458(EMBL): repeat (LINE/L1)
XX
SF  multiple putative SATB1 binding sites [1]; motifs with
SF  similarity to the Drosophila topoisomerase II consensus
SF  [1]; DNA unwinding motifs, A- and T-box motifs [1]
XX
TP  concluded to be permanently attached [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AF156545; AF156545
XX
RN  [1]
RX  MEDLINE; 99412420 PubMed; 10481016
RA  Rollini, P., Namciu, S. J., Marsden, M. D., Fournier, R. E.
RA  K.
RT  Identification and characterization of nuclear matrix-
RT  attachment regions in the human serpin gene cluster at
RT  14q32.1
RL  Nucleic Acids Res. 27:3779-3791 (1999)
//