S/MARt DB - S/MAR

AC  SM0000219
XX
DT  30.11.1999 18:46:02 (created); ili
DT  27.2.2002 16:53:00 (updated); ili
XX
NA  HS$CBG-5MAR1
XX
SY  CBGp MAR, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  1115 bp
XX
LO  14q32.1
DE  G000199; alpha1-antitrypsin
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -2
DE  G001403; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: -1
DC  one of 3 S/MARs between ATR and CBG genes, located most
DC  distal to ATR [1]
DE  G001547; corticosteroid-binding globulin
DP  Direction: 5'; 2300 - 1200; Pos 1: transcriptional start
DN  Internal: n; Gene position numeral: 1
DC  one of 3 S/MARs between ATR and CBG genes, located most
DC  proximal to CBG [1]

G000199;
alpha1-antitrypsin
G001403;
serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2
G001547;
corticosteroid-binding globulin

XX
SQ  AAGCTTTAAATAAATAATCAACATAAATATGAAGATTTAAATAAAATAAGCTCAAGTTAT
SQ  TACATATATACATATATGAATGTGTATATATACATATCAAACAGATATCCATTATTTTTT
SQ  AAAGAAAACATGAAATGTTTATTAAAATAGGCCATATATGAGCTGGGCACGGTGGCTCAC
SQ  GCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGGCGGATCATGAGGTCAGGAGATTGA
SQ  GACCATCCTGGCTAACACGGTGAAGCCCTGTCTCTACTAAAAATAAAAAATATTAGCTGG
SQ  GCATGGTGGCTCACGCCTGCAGTCCCAACTACTCGGGAGGCTGAGGCAGGAGAATCCCTT
SQ  GAACCCAGGAGACGGAGGTTGCAGTGAGCCGAGATCACGCCACCGTACTCCAGACTGGAT
SQ  GACAAAGGAAGACTCCGTCTCGAAAAAAAAAAAAAAAAAAAGACCATATATGGTTATTAC
SQ  AAACCTCAAAACATTCCAAATGTTCAATATCATAATGGACAATATTCTTTGACCATAGTG
SQ  AAATAAAATTGGAAGTGAATAACAAGAGAATAGCCTAAAATTCTAAATAAACTCAGTGAC
SQ  ATATTACTAAACTACACTCTGGTTTTAAAGGGAAACCAGAAAAGAAATTTTAAAATACTT
SQ  AGAAAAAAATTACAATGAAAATAGTAATTATCAAAAATGCGTGGGACATAGCTCACTCAG
SQ  TATTTAGATGAAAACTTGTAACCTTAAATACATTTATGTGGAGACTGGAAATATTAAAAT
SQ  GTAAGAAAGCTAAGCATTTATCTCAAGAAAATAGAAAAAAGCACAACAGACCAAAACCCA
SQ  GAGAATTTAAAGGGGTGATTAAAAAATAAAGATATAAACAGAAATCAATGAAATATCAAT
SQ  TTTTTAAAAAACCAGTAACAAAACTAAAAGGTGGATCTTTGGAAAGATTAATTAGCTATA
SQ  TAGATCTCTGTAACAGGACTTATCAAAGGGAGAAAAGACATAAACAAAATACAGAACAAA
SQ  AAAAGAAAAAAGAATTACTGATATAAAATAATAATGTAAAAATAATAATGGAGAGGCCTA
SQ  ATGAATAACTGTAGTATTTAATTTGAAAATCTAGA
SC  EMBL #AF156543; release 61
XX
FT  54 - 90: TA stretch (31/37)
FT  93 - 153: repeat (LINE/L1)
FT  154 - 454: repeat (SINE/Alu)
FT  455 - 1008: repeat (LINE/L1)
XX
SF  multiple putative SATB1 binding sites [1]; motifs with
SF  similarity to the Drosophila topoisomerase II consensus
SF  [1]; DNA unwinding motifs and T-box motifs [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: AF156543; AF156543
XX
RN  [1]
RX  MEDLINE; 99412420 PubMed; 10481016
RA  Rollini, P., Namciu, S. J., Marsden, M. D., Fournier, R. E.
RA  K.
RT  Identification and characterization of nuclear matrix-
RT  attachment regions in the human serpin gene cluster at
RT  14q32.1
RL  Nucleic Acids Res. 27:3779-3791 (1999)
//