S/MARt DB - S/MAR

AC  SM0000220
XX
DT  30.11.1999 18:50:43 (created); ili
DT  21.2.2000 16:19:59 (updated); ili
XX
NA  HS$CBG-3MAR1
XX
SY  CBGi MAR, 
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SZ  5303 bp
XX
LO  14q32.1
DE  G001547; corticosteroid-binding globulin
DP  Direction: 3'; Pos 1: transcriptional start
DN  Internal: y; Gene position numeral: 0
DC  locates to intron 1 [1]
XX
SQ  CAGCTGCTATGATTGGCTGAGACTTGGTTACTTGTTACAAACATATACTCTCAAGTTAGG
SQ  TGCAGTTTGTTTACATATTAAGCTAGGTTACAGTTTGCTACATGAGGAGGCAGCTTTAGC
SQ  CCATCTTTAATTTAATTTAACACAACACAACCTCCTGGAGCACTGGTTTAAATGATGGTT
SQ  CCCAGCCCCTCACCCAGAATGGCTGGTTCAACAGTGGGTGGTGCAGTAAGACCTGCTTCT
SQ  CCTGTAAGCATCCTGTATTTATTGTGATACAGGTAGCTCCACACAGCACAGGGCCTGAAA
SQ  CCACTAACCTTGCAGGCAGGCAGTGTCCACCGACTGATTCCAACCTTGGGTGGATTTTTT
SQ  TTAATTGCTCTTATGGAACTCTTTTTAAATCATTTATATTTAATTTTTTCCTTAAATTTG
SQ  TATTGTGGGAAAATATAATACCTAACGTTTTAACTACAAGCATACAGTTCATAAAAGTAC
SQ  ATTCACATTGTTGTGCCACCATCACCACCTTCCATGTCCGGAACTTTTTCATCATCCCAG
SQ  ACTGAAACTCTATACCCACTCAACAATAACTCCCCAATCTCCCGTTGCCCCGGCCCCTGG
SQ  TAACCACAATTTTACTTCTGTCCCTAGGTATTCGGCTACTCTAGGTGTAGAATTAGACTC
SQ  TATTTGTCCTTTTGTGTCTGGCTTATTTCACATAACATAATGTCTTCCAGGTTCATCCAT
SQ  GTTGTAGGAAATGTCAGAATTTCATTCCTTTTTAAAGTTGAATAGTATTCCATTGTATGT
SQ  TTATACCAGACTTTGTTTATTCATTCATCCATTGATAGACATTTGGGTTGTTTTCATCTT
SQ  TTGGCTATGGTGAATAATGCTGCTGTGACTTTGGTCTACAATTATCTTTTCAAGTTCCTT
SQ  GACTAGCTGCTTGCAGTTCTTTGGTGTATATACTCGAAGCAAAATTGTTGGGTCAAATGA
SQ  CAATTTGTTTAATTTTTAAAGAACTGTCATATTGTTTTCCACACATTGTAGCACTTTATA
SQ  TTCCTACCAGCAATGCATAAGGGTTCCAATTTCCCCACATGCAATGCTAACATTTAAATT
SQ  AAAAAAAAATTTTTTTTAAAGGAAATCTTGCTATGTTACCTAGGCTGGTCTCATACTCCT
SQ  GGCCTCAAGCATTCCTCCTGCCTCAGCTTTCAGAGTAGCTGGGATTACAGGCACGGGCCA
SQ  TCATGCCTGGTGTGCCAACTTATTGTTTTCTGTTTTGTTTGTCTGTTAGTAGCCATCCCT
SQ  GTGGATACGAAGTGGTATCTCATTGCGGTTTTGATATTCCTAATGATTAGTGATGCTGAG
SQ  CATCTTTTCATGTGCTTACTGGCCATTTGTATGTTGTCTCCTGAAAAGATGTCCACTCAA
SQ  GTCCTTTGCCCATTTCTAACTGGGTTTATTTGTTTTGTTGTTGTTCTTGGGTTTTAGGAG
SQ  TTCTTTAATATCCTGGATATCAATTCCTTATCAGATATGAAATTTGCAAATGTTTTCCCA
SQ  TTCTGTGAGTTGCATTTTTACTTTATTGATAGTATCCTTTGATGAACAAAGTTTTCAATT
SQ  TTGATGAAGTCCAATTTGTTTATTTTTTATTTTGTTGCCCATGGCTTTGGTGTGATATTC
SQ  AAGAAATCATTGCCAAAGCCAACATCATGAAGTTTTTCCCCCATGTTTTTTTCTAAGATT
SQ  TTTATAATTTTAACTCATCTTTAGGTCATTGATCTATTTTGAATTAATTTTTGTATATGG
SQ  TGTTAAAGGTCCAATTTCATTATTTTGCATGTAAATATCCAAATTTTCAGCACCACTTGT
SQ  TGAAAAGGCTGTCTTTTCCCCATTGAATGGTCTGGCATCCTTGTCAAAATCATTTTACTA
SQ  CATATGAAAGGCTTATTTCTGGGTTCTGTATTCTATTCCATTGGTCTCTATGTATGTCTT
SQ  TATGCCAGTACCACACTGTTTTGATTATTATAGTTTTGTAGTAAATTTTGAAATCAGAAA
SQ  GTGCAAGACTTTCAACTTTGTTCTTCTTCAGTATTGTTTTGGCTATCCAGGTCCCTTGAG
SQ  ATTTTTATATAAATTTTAGGATAAATTTTTCTATTTCTGTGAAATACAGAACTGGAATTT
SQ  TAATAGGAATTGCATTGAATCTATAGACTGCATTGGATAGTATTATCATCTTAGCAATTT
SQ  CTTCCAATCCATGAATGCAGGATGTCTTTCCATTTATTTATGTCCTCTTTAATTGCCTTC
SQ  AGCACTGTTTTGTACTTTTCAGTGTATGTCTCTTACCTCCCTGGATTAATCCCTATTTTA
SQ  TTCTTTATCATACTATTGTAAATGGAATTGTTTTCTCAATTTCCTTTTCAAATTGTTTTC
SQ  TTTGTTAGTGGTGGGAAATGCAATTGATGTTAGTGTTTTGATTTTATATCTTGCAACTTT
SQ  GCTAAATGTGTTTATGAGTTCTATAGAATTTTTAGGGTTTTGAACATATAAGATCATGTC
SQ  ATCTGTGAACACAGACAATTTTACTTCTTCTTTTCAAATATGGATACCTTTTCTTTCCTT
SQ  GCCCAATTGCTCTGGCTAGAAATTCCAGTGCTATATTAGGTAAAAGTAGTGAGAACAAGC
SQ  ATCCTTGTTTTGTTCCTGATCTTCGGGGAAAAGCTTTCAGTCTTTCACTATTGAGTATAA
SQ  AAGGTTTTATAAATACGTAGTCTTGATTATGTTGAGGTAGTTTTCTTCTATTACTAATTT
SQ  TGTTGTAGGACTTTCTACTTAGTCCAGCTAAACACGGGGTCCTTGTCACATGGCCATGAA
SQ  AGATTAGGCTCACAGACACTTTGAGGTGTGAATAAAATGGAATTTATTGGGTGAAAAGGA
SQ  AAACAACTCAGCAAAGCAAGAGAGAGTCCTGTTAACAGGCCCTCATCTGACTGACTGAAT
SQ  CCCCAGATTACCACATCGGATCAGGAGAGAGAGGCCAAGCTCCTCCCCGCTGCAAAGGGC
SQ  ACAAACTTCCCACAGCTCCACCCCATTCTCCCAGTGTGCAGGCCAACTGAATGTTCTCCA
SQ  GGCACCTCTTTACACTTGACTGTCTCAATCTGCTGTGTGTTTTTATCATGCGAGGGTGTG
SQ  TTGAATTATGTCAAATACGTTTGTCTGCACCAATTAAGATGATCATGTGATTTTTTCTTT
SQ  TATTTTGTTAATATGATGTATTACACTGATCAATTTTTGTATGTTGAAAACATCCTTGCA
SQ  TTACAGAAATAAATCCAAATTGGGTATGGCATATAATCCTATTAGTAGGCTCTCAAAATT
SQ  AATTTAATCCATTATATTAGTCAGGGTTCTCCAGAGAAACAGAATCTATAGGATATATAG
SQ  AAATATATATAAGAGGAGGCATTATGGGAATTGCCTTATGTAATTACAGAAGCTGAGAAG
SQ  TCCCACAATCTGCCATCTGCAAGCTGGAGACCCAGGAAAGCCAGCCATGTAATTCAGTCT
SQ  GAGTCTGAAGGCCTGACAACCGGAGGAGCCAATGGTGCAGCTCCACAATAGGAAAAGGGC
SQ  CTAATAAGGCTGCTGGTTTAAGTCCCAGAGTTTAAAGGTCCAAGAAACAGGAGGCCCAGT
SQ  GTTCAGGGCCGGTAAACACAGATGTCCAGCTCAGGGACAGAAGAGAGAATTTGCCCTTCT
SQ  CCTACCTCTTTGTTCCATTCAGCCTTTAATAGATTAAAAATGCCCACCCATATTGGTAAA
SQ  GGTGGCTGTCTTTAACTCAATCCACTGATTCATATGCCAATTTCTTCCAGAAATACTGCC
SQ  ACAGGCCTCTTTTATGTAGGCACTAATTCCTTTTATGAGGGTAGAGCCCCCATGAATAGG
SQ  TTTCCACATATGAATTTGTGGGGACACAAACATTCAAACCTTAGCAGCTGGTAAAACATT
SQ  ATTTTTGAGTGTGTCTGGGACAAAATAAATTGAGCAAAAATGGACATAATTGAAGGGTGA
SQ  AATCGTTCTACAGCAATTTAGACACTTCAATATCTCATTCTCAATAATGGATAGAACAAC
SQ  CAGACATAAAATAAGTAAGAAAATAGAGAACTTGAATATCACACTAAAAGCTAGATGTAT
SQ  CAGACCTATACAGAACACCCTACAACAACAGAATACACATTCTTCTCAAGTGCAAATAGG
SQ  ACATTCTCCAAGATAGACCCTATGTTAGGCCACAGATCAAGAGTCAATAGATTTTAAAAG
SQ  ACAGATATCATACTAAGTTTCTTCTTCAATCACAATGAGATGCAGTTAGAAATCAATAAC
SQ  AGAAGGAAAACTGGAAATTTTACAAATTGTGGAAAAAACAACACACTCTTTATCAACCAG
SQ  AGGATCAAAAAAGATACCACCAGGGGAATTAGAAAATACTTAAAGACAAACGAAAATGGA
SQ  AACACAACATACCAAAACTTATGGAATGAGTGAAAGCAGTGTGATGATAGAAATGTAAAG
SQ  CTGTAAACACATTAAAAACAAGAAGATCTCAAATAAACAATGGCATATATTCAAATTCAG
SQ  GTGTTAACTTTAGGATGCTAATGTAATCCCCATAATAACCACAAAGGGATGAGAATAGAA
SQ  TTATTAAAGTGTTTCAATACAAAAAAGCATTTCAGTACAAAAACTAAATACAAAAAAGGA
SQ  CAGTAATATAGGAAATGAAGAACCAAAAATGTTATATCTTCTTGCTGTACTGAAAACTTT
SQ  ATTAATATGTCATTGCCCTGTCTTTTGGAACTTTTTTAATTCAAAATCTATTTTGTCTAA
SQ  TATTAGTGTAGTCACCCCTGCTCTCTTTTGATTACTATTTGCATGGGGTAACTTTTCCAT
SQ  CCTTTCACTTTCAGTCAGTCTATTTACATTTTTGGATCTAAAATGAGTCTCTTGTAGACA
SQ  GCATATATTTGGATCATATTTTAGAAGGCTAATGTGTAAAAATTATTTTTAGTCTTTGTT
SQ  TATAATTTAGAGACTAGAAAAAGAGCAAACTAAACTGAAAAATAGCAGAAGGAAGGAAAT
SQ  AATAAAGATTAGAGCAGAGATAAATAAAATCAAGAATAGAAAAACAATAGAGAAAATAAA
SQ  TTAAACCAAAATGTAATATGTATGCTCATAATACATTTAGTCCATAGTATATTTGATATA
SQ  ACCAGCTTTACTTCAATAGCATACAAAAGCTCTGCTTCCTTATWAGCTCTGTTCCTACCT
SQ  GTTTCCAGTTACTGATGTAACAAATTAATATCTACACATCATGTGCCCAAAAACATAACT
SQ  TATAATTGCCCACGCATCTACCTTTACCAGAGGTCTTTTATTTCTTCATTCAGCTTAAAG
SQ  TTACTGTCCAGTGTCCTTTCATTTCAATCCCGAAATAAAATGCCTCTCATTTCTTGCAGG
SQ  GTAGGTATTGTGGAAAAAAGCTT
SC  EMBL #AF156544; release 61
XX
FT  1 - 119: repeat (LTR/MER4-group)
FT  419 - 1086: repeat (LINE/L1)
FT  1087 - 1207: repeat (SINE/Alu)
FT  1208 - 2699: repeat (LINE/L1)
FT  2700 - 3026: repeat (LTR/MER4-group)
FT  3027 - 3230: repeat (LINE/L1)
FT  3252 - 3725: repeat (LTR/retroviral)
FT  3722 - 3825: repeat (LTR/MaLR)
FT  3826 - 3859: repeat (LTR/retroviral)
FT  3860 - 4420: repeat (LINE/L1)
FT  4420 - 4595: repeat (LINE/L1)
FT  4589 - 4813: repeat (LINE/L1)
FT  4868 - 4990: repeat (LINE/L1)
FT  5030 - 5166: repeat (LINE/L1)
FT  5159 - 5302: repeat (LINE/L1)
XX
SF  multiple putative SATB1 binding sites [1]; motifs with
SF  similarity to the Drosophila topoisomerase II consensus
SF  [1]; DNA unwinding motifs and A- -box motifs [1]
XX
TP  concluded to be permanently attached [1]
XX
EV  in vitro selection of S/MAR [1]
EV  in vivo selection/LIS [1]
XX
DR  EMBL: AF156544; AF156544
XX
RN  [1]
RX  MEDLINE; 99412420 PubMed; 10481016
RA  Rollini, P., Namciu, S. J., Marsden, M. D., Fournier, R. E.
RA  K.
RT  Identification and characterization of nuclear matrix-
RT  attachment regions in the human serpin gene cluster at
RT  14q32.1
RL  Nucleic Acids Res. 27:3779-3791 (1999)
//