S/MARt DB - S/MAR

AC  SM0000224
XX
DT  14.12.1999 14:59:24 (created); ili
DT  14.12.1999 17:01:32 (updated); ili
XX
NA  CAEEL$MARa
XX
OS  Caenorhabditis elegans
OC  eukaryota; animalia; metazoa; nematoda; secernentea;
OC  rhabditia; rhabditida; rhabditina; rhabditoidea; rhabditidae
XX
SZ  1343 bp
XX
LO  3
DE  G001600; UDP-glucuronosyltransferase
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; 
DE  G001601; 
DP  Direction: 3'; Pos 1: ATG
DN  Internal: n; 
XX
SQ  AATTCGTCATTCCGATAGGAAAGATCCACGTGGAGATGTACTCTCATCTTTGAGAGATTC
SQ  ATCAGATGAATGGATGGGAATTGATGATCGAATTGATTCTTCATTGAAGTATGTTTATTC
SQ  TTTGAAGTATTTTAATTAGTAATTTCTATTTTCAGATACTCCCGTGCTGCAGCTGGTACC
SQ  GTTATTGTTGGTGACACCGAGCTGATGCCAGTGATCAATGATAACGACTATATGACGATG
SQ  AAACCACGAAAGGACAAGAACTTCGAACGAGAGAAACCTCCAGCTATTCCTGCTCATGCG
SQ  ACTCCGCTCGAATCTGTACTCAAATTGGGTAGCTCTTCAAGTGGAGAAGAGGCTCCACGA
SQ  AATGCATTATACGACGATCCGATCTCATTAGATTCACAGACTTTTGATGATATAGACGAA
SQ  GAAGTCAACATTCACATCTCTTAATAACCTTCAGTATTTCTTTAATTCACAATTTCTCAA
SQ  AATCAAGGTGCTTTTTTCCCTTTCTCTTCCCATAATTCTTTCATTCATTTTCTCCCCCGT
SQ  GTTATTACCGATATGTATTAAGTTTCTCCAAAAACCTCACAAAACCTTTGCAACAACCAA
SQ  AACCTCAATTTGTTCACTTTATTGCTGGAAAATCCACCCGATTTTATGGGTCAACTTGTT
SQ  ACGTGTATCTACAACCCTTCACGACTCAAACATTTGTTCACATAGCTTTGTATTTCAAAC
SQ  ATTTTTTCTATTCGTGTCTTTTTCTGCTGTTCATAATAAATTATTCAATAATAATTCACT
SQ  GTGTTAAAGTTTTTTAGCAGAACTTAGTAAATTGGTATAAAAATCTGGATTTTTAGTTTT
SQ  GAAGAAAATATCAATAATTTCACACAAGTTTTCATATTTTTCTAAACAAAACATGGAAAT
SQ  TCGAAACTTAATTTTCACAGCGAACTGAAATATTATTAGCACAGTTTAACTTAAAAGGTA
SQ  CAGTAACCACACGAGTCTCAAGCCTGGCTTCGCCCGCAACCCATCTCTCCTCATTTAGCC
SQ  AGCCTACCTCTGTATGCATAGCAAATTAAAATCAAAAATTGTTTTTTTAATCATTTATTC
SQ  AACCCGAAAGATTATAAAATAAAATTAAAAAAAACAAAAAAAACAAATTAAAATAATTTA
SQ  TAAAATCTCCAAAAACCTAATCCTTTTTAGTTTTTGTTTCACACTTTTTACAGAAACAAC
SQ  ACCTGATTACAGCTCTCATGAAACGGTATCCAATATAAAATACAATGAAAATAACAATGA
SQ  AAAGGAATGTAATTACATCAAGTGAATGATATTGGAAGAAGTTAAGCTTTTGACCAGCTG
SQ  GCTCCAAATTATCAAGAGTTTTG
SC  EMBL #Z34802; nt 2633-3975
XX
FT  1248 - 1263: MRS: large half site motif (15/16) [1]
FT  1250 - 1257: MRS: small half site motif (8/8), overlapping
FT                 the large half site [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z34802; CEM88
XX
RN  [1]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//