S/MARt DB - S/MAR

AC  SM0000225
XX
DT  14.12.1999 15:03:29 (created); ili
DT  15.12.1999 18:09:34 (updated); ili
XX
NA  CAEEL$MARb
XX
OS  Caenorhabditis elegans
OC  eukaryota; animalia; metazoa; nematoda; secernentea;
OC  rhabditia; rhabditida; rhabditina; rhabditoidea; rhabditidae
XX
SZ  1584 bp
XX
LO  3
DE  G001600; UDP-glucuronosyltransferase
DP  Direction: 5'; Pos 1: ATG
DC  Hind III fragment overlaps with the intergenic region
DC  between M88.1 and M88.2 genes as well as with the 3' end of
DC  M88.2 gene [1]
DE  G001602; mitochondrial ribosomal protein S34 like
DP  Direction: 3'; Pos 1: ATG
DC  Hind III fragment overlaps with the intergenic region
DC  between M88.1 and M88.2 genes as well as with the 3' end of
DC  M88.2 gene [1]
XX
SQ  AGCTTAAAAGAAATTTAGAATTCAAAAAGCGAACCCTTTATATTCTTCGGAATCTTCACA
SQ  TCAGTTTTGTAATCTGGCAAATGAGAAAGATGAATCATTGTGACGTCATGTCCTCCATTG
SQ  GCAAGAACTTCGGCCACACGAGTACAGAATTGGACCTGAAATGCAATAATTTAGAAAGTT
SQ  TATTAAAATTATACGAACGTTTTAACTGTTTTGTTTTAAATTTCAGTCAGTAGCACATTT
SQ  TCTCCATTTTAAACTGTTTAATATGGAGAAGCATCGAACTTTTTTGGTAACTATCATTAT
SQ  AGTTATATATAACCAAATATGAATGTGAAAAGTTTGATCGTTTTTTTTGGTTTTATGTCT
SQ  GTGACGATTTCAATCAAAGGGAAAAGAAAATTTTTCCAATTTATGTACCAAAGAACTTTG
SQ  ACTACTATAAATTTGACCTAGACTTAACAAATGCTCCACATAGTATGAAATATTTCTCGA
SQ  TTAAAGTTTCTCAGCTCACCTGACTATTAGCCATATATGGTACAAAAACCGCATATTTGT
SQ  ACGCGGAAACTGCTCCAAGCAGTAGAAGAAAAAGAGCAATCAATTTCATTTCTGAAACAG
SQ  AAATTGAGAAAACTTTGTCCATACATCGTTGTTTAAATACTCTTTTATTTGCATCATTTC
SQ  TGATAGTCAATCACAAACCCAAGTTTCCTAGAGACAACTAGACTAAAAAAGAGAGCCGTA
SQ  GAGAATTATAGACAATGCTAATTTATAAATCAGAAATGTGGTTTGTAGGAAGTTATGGTT
SQ  TGGTGCTTTTCTGAAAAAAAAGTACTGATTCTAAATAGGCTCTTATCTTATCACAATCTG
SQ  TTTTACATCATTGTGTTGTTTGTGCATCCAAAACGTAAAAATTATTGTGAAATATCATCT
SQ  TAAATATTTAGTGGAGTGTAATAATCAAATAATCTTGAATAAAGTTGCGCAGGAAATCTG
SQ  ATGCATTGTGTTACGGTGGGTGCACAAATTTTCCAAATGCACCGAATTCCACGCGCAATT
SQ  TCAATTTTTAAAGTTAAAGCCACCAAAAAACATAGTTGTACCATTAGATTTCTGGACTGA
SQ  CTATGAGTATTCATTTTTCACAACTCTCTTTTTCACAACGTCAGTAATATTTTCCCTCCG
SQ  CTGTTGCAACTTATTTAGTCACAGTAAGTACTGTATTCAAACCTGAGTTTATTTACGCAA
SQ  ATTCGCCACTGATGTTTGGTTCGTTTCTGTTAATGATTCAACTTGTTCAACTCATACTGT
SQ  TATAACGAATGCGTTCTCTTTAAGTTGTGATCTATATTTTATACATTTTTGTATTTTTGA
SQ  ATTAATCATTAACATTTTTTTTAACTATCACAAATTTCACTTCACTGTAGTCTTGGAACA
SQ  ATGTGACTTGGTTCATGATAGTTTAATTTTAAAACTCTAACGAAACAGAACAAAAAGAAA
SQ  ACAAAGTCTAAAAACAACTGCTACAATCGAAAACTTAAATTTAAAAAAAATTAAATTGAA
SQ  AGAGAATCATTTCGGTGGTTGCTCTTCAACTCTCATCGTTGTGGCATTAAATCGTGGTTG
SQ  GAACATTGCTGGTCCTGCATTCCA
SC  EMBL #Z34802; nt 6448-8031
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z34802; CEM88
XX
RN  [1]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//