S/MARt DB - S/MAR

AC  SM0000226
XX
DT  14.12.1999 15:05:13 (created); ili
DT  15.12.1999 18:09:36 (updated); ili
XX
NA  CAEEL$MARc
XX
OS  Caenorhabditis elegans
OC  eukaryota; animalia; metazoa; nematoda; secernentea;
OC  rhabditia; rhabditida; rhabditina; rhabditoidea; rhabditidae
XX
SZ  828 bp
XX
LO  3
DE  G001603; 
DC  may overlap 5' part of the M88.3 gene
DE  G001604; 
DP  Direction: 5'; Pos 1: ATG
XX
SQ  AATTCCAGGTACTGGCTGAAAATTTTCTAATATTATATTGAAAATGTTAACTTTATAAAT
SQ  AGTAAAACTCACCAAAAAAGAAGAAAATGAGCTTGCAGATGAGAGAAGTGAATTGTTTGT
SQ  TTCATTCGAATTGAAATCAGTCATCTTTTTATGATTTTCCGTCCTCGTTTCAATGGAATC
SQ  ACACAAATGACGGGCGGACTGAAGAAGATCACCAAATTTGATGATATGAATAATAAATAA
SQ  TAAATTTGATACCGATTAGCAAGAGTGTTTTTTTTTAAATTAACGTAAAAAATCGGTGCA
SQ  AAAGTTTTTTTGAAAAGTTCATAACCTTTTACACGCTAAAAACAATGTTTAATATTTGTA
SQ  AATAATTTTCAAAATTTTATTATTTATTAACAGAAAATATTTCAGATCAAAATTTATTTT
SQ  AAAACATTATCTTTCAAATTTCATACGTCTCGTTTTTAATTCGGATAAAAAATTATTTCA
SQ  AACAAATTATTGTTTCCAGGCGCAAAATTTTGCGGATTGTGCGCTAAAAATACGGTACCC
SQ  GGTCTCGACACGACAATTTTTTATTAATTCTAAAAATGTGTGCGTCTTTAAAGATTACTG
SQ  TAAATTTAATATTTCGTTGCTGCGAAATTTTCATTGATTTTTAAAAACTCAAATATAAAA
SQ  ATAAAAAGCTGCATAAATTTTAGCAAGTCGTGAGAAAAACTATTAAAAATTCCACAGAAA
SQ  GTTTGAAATACAGTACTCTTTAAAGACGCACACATTTTTAAATTTAAAAAAAGTACCGTA
SQ  TTTTTGGCGTAATAGTTACGAAAATTCGAAAATATATGCACACCTGCA
SC  EMBL #Z34802; nt 11246-12073
XX
FT  229 - 236: MRS: small half site motif (8/8), adjacent to
FT               the large half site [1]
FT  236 - 243: MRS: small half site motif (8/8), overlapping
FT               the large half site [1]
FT  237 - 252: MRS: large half site motif (16/16) [1]
FT  377 - 384: MRS: small half site motif (8/8) [1]
FT  405 - 420: MRS: large half site motif (15/16) [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z34802; CEM88
XX
RN  [1]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//