S/MARt DB - S/MAR

AC  SM0000228
XX
DT  14.12.1999 17:23:35 (created); ili
DT  15.12.1999 18:09:44 (updated); ili
XX
NA  CAEEL$MARe
XX
OS  Caenorhabditis elegans
OC  eukaryota; animalia; metazoa; nematoda; secernentea;
OC  rhabditia; rhabditida; rhabditina; rhabditoidea; rhabditidae
XX
SZ  3729 bp
XX
LO  3
DE  G001605; hnRNP K
DP  Direction: 3'; Pos 1: ATG
DC  Bgl II fragment comprises 3' region of the M88.5 gene as
DC  well as the intergenic region between M88.5 and M88.6 genes
DC  [1]
DE  G001606; 
DP  Direction: 5'; Pos 1: ATG
XX
SQ  GATCTCACATGTTGAGAATCCGTACTGAAGTGTCCGTTCCAACTAGAATCATTGGTAGAA
SQ  TAATTGGAAAAGGTGGACAGAATGTTCGTGAGCTACAGAGAATTACGGGTGCTGTGGTCA
SQ  AGATTCCAGAAGAAGAGCGAAATGGAGGAGAGGTTTATAGACACGATGATGGTGGGTTTT
SQ  TTATTTTGTAAAATGTTTCTTTTTGAAAATCGAAAAACTAAAATGTTGAATTTTTCACTC
SQ  TTTTTTCACATAAAAATGAACTTATTCTTAATGAATCTATAGAATACTTGGGTTTCCAGT
SQ  TTTTATATTTGTTCTGAAAAAAAAATTTAAAAATTGAATATTTTTCTGATTGGTTATAGT
SQ  ATTCAGTTATATTTTTAAAAGAAAAATACGAAAAAAAAAATCCAAGAAGAACGAGACAAT
SQ  TTGATTGAAAAAGTCCAGAAATAGGAAGATACTATTTTTCGATTATTTATATGAAAGTTT
SQ  TGAAAATAGACTCTGCCGCTTTATGAGCTTTTTCGCGTTTTTCAAAAAAAAATGTATCGT
SQ  AACTTTTTCGTACTTCACTTCTAAATTCTAAGTAATATGACTGAGTACACAAGTGATTGT
SQ  ACACCATCAAAATTCAGAAAATTGAAACTAATCTTTTCAATTTCTTATTTTTCAGGTCTC
SQ  GAAGAAGACATGACTATGATAAGAACTATTGGAAATATGTACTCAACTCATAATGTGCAA
SQ  TTCCGACTTGCTCATCTTGTAAATGAGTATTATCGTTCCGGAGATCATCGCAATAAGTCA
SQ  TCTGATTATAAAGGAGGTCGACCACATTCAGCCCCATCATCAGGTCAAGAAAAAGATGGT
SQ  AAGCTACTGAAAGGACTTGACACTTTTTTTTTTACCGAGTGAACAGTTTTCAGGTTCCGC
SQ  ACTCGAAAAAATGGACCAGCTGGGCACAATTGCACCAATTAGCAATTCGAATCGGGCTTC
SQ  TCCAAAATCTGTTTCTCCTCCTAAATCCAAATCGCCATAGAATATAGTTCTACGGTTTCC
SQ  AGTTTTTTGTTGAAATTTTCCATATTATTCTTTTGTTTTTTTTTTCTTTTTCAATTTCTT
SQ  CCCTTTGGTTTTATGTCCCGCACCATCAAAACAAGCATTTTCCCGTTGTCTTTTCCCCGT
SQ  CCCGCGTTGAGCAATTTTTTGAGAATTTAAGTTTAGCACATATTTCGCAACAAATTTACA
SQ  TTCATTTCTTTACGAGCATATCCCGAACCAATACATTTTCTGAAGAATACCCCCCTCCAT
SQ  CCCCAATGTTATTCCAATTGTTTTTTAGGAATATTTTCCCATTTCCCCCCTGACGGGTGC
SQ  GTACTGTATTCTCGGTCTCTTCGACGGGACGTTGCCCCCAACCAGAATTTGAGAACATTT
SQ  TGCAAAAATAATAATAACTTTAATTTCTAGACGTAGGCTAGACTACACAGCGGGTCTCTA
SQ  CATGACCTTAATAGGTCTAGTTAACTATTGCTTTTCCCTAGAATCGTAAATGCTCTCACA
SQ  ATTTCTTCAACGCTCCCCGGCGACGCCACCAAAAGCCCACCACCATCACAACAGTTTCGT
SQ  TCTGATATTTCAGATGTAACTCCCAACTGTTCACTCTGAAAATTTTGGAAATCTGTTCCT
SQ  TCTCTTCCCCCTTTGAAATGTTTCTGGTAATAATGATAACTTTTTGCGAATGAATGTGTC
SQ  CTAAAAAGTTGTAAGCCTATTTCTTTTTCCAGGTGCACCATTATTTAAATTATGACGTCA
SQ  TTGCCAACGAACTTCTCGAACACGGAACAGCCGCCCCGTTGCCGCGCGGAAGAGATCATT
SQ  TCTCCGTTTTTTTTAAAGAACCTCTCCTCAGACACACCCCGTTCATTGAGAAACGCAGAC
SQ  AGCACACGAAAATGACCTCGGCCTTCAAATAAAGGCGAGAGAGTGTGTAAAATATAGAGA
SQ  TAATCGACAAGACGGGCAGCCTGACACTGCCTTGCACGGACTCTGCGTCTCTCTTTCCTT
SQ  CCCACTCTCTCCACGCTTCCCTTCTTTTTTTCTTCTCGTTCCAATCGCCGACTGCGCAAT
SQ  TTCTACGTGGGTGCCAGTGCCCAGCTTGCGTTTTTTGGCGATATTATTGCGTTTGTTTTC
SQ  GAAATTCGACTTAACAAAGCATTATTATTTTAAAACATACTTTATTACATATTTGCAAGC
SQ  TTTTTCAAGATTCTTCAATCGCGCTCCATTGAGAAACTTCAATTTATTTTGATGAGCTAG
SQ  TTATTATATTCTTCAACATTAATTTTGTTTTCCAAGTTCAGTTGATAAATTATTTATTTT
SQ  TTAATTCTCCTGTCGTAATTTCGAGATTTATTATTCTGATGGGTCTCGCCGCGTAAAATG
SQ  TTTATGGTGGAACCAGATTTTTTTCTTTATTCAGAAGTTAATGTGTTTTTTTCTACCTCA
SQ  CGATATCTCACTATCGTAATAAATTAAATTAAATTAAATTAAATTAAATGTGCAAGCAAA
SQ  TTTATCCGGTTATAACTATATTGTTCAAGTATTCTGTATTTTAATTACTATTTTTAACAA
SQ  CAAAAAAATCTACCATAAGCTTTTACCGCGGCGAGACCCATCCGAATGAATATATGCACC
SQ  TTTAAATGTATGTCTTAGAAAATCGCGAAATAACGATAAATCCATGAAACTTTTGCAATT
SQ  TGAATTTTTGAACAATTCCCGACCTCTGCATCGTTATCAGTATGTTTGGAAGAAAAAAGT
SQ  GATTGGGCAGTAAAATTGTCTATGTCAATATGGTTTCTGTCTGAAACTCTTCTATTTGAA
SQ  ACTCTGATTTTGAAATGACCACGCCGGCGAACGTTTTGGTGTTTGATTTTGAAAATGATT
SQ  TAAATAAATTGTAAATATTTACAACAACAAAAAATTCCGAGCGATTATTTAAAAATTGTG
SQ  CGTGAAATGTGATGTATTAAGGTTACTGGAAAATAAATCACATTTTACTATTCAATTTTT
SQ  TATGCAACTGAAACTCCGCGAAAGTACAACAATGATTCCTCATAGGTTACAAAGAGTTTC
SQ  TGAAGTATTTAAAATAAGGAACAATTGATAATTCAACATTCAAAATCACATGCTTTTTTT
SQ  CCGTGACAAGACCCAAAAATTTCATAAGATAGGTTTGGTTTCAACGTGAAATTACTTCAT
SQ  AGGATCTTGGCACGAACCTGACTTTCCAGACAAATACCGTACTTACAAGTTTTTCCAAAT
SQ  TTTCACTGTTTGATTTCTATTCTAAAATTCTCGGGGGTACTGTAGCTAGAATTTTTTGCT
SQ  CGTTCCAGGACCCAAATGAGACATTTTTCTTTAGTAACCTTGACATAATTCCAGAACATG
SQ  TAATTTCCCGTTTTCTGATTCCTTAAAGTAAGTTACCCAAAGATATAGTTTCATTTATTG
SQ  GAAGGTCATGATAAACCACCTTGACACCTTTTTCTCTAAACTCTACTCTTATCTAGTACT
SQ  ATCTATTGAAAAAAAGAACTAATGTTCATCTCCCTCTTCTTCTTCTTCATTTCAATCGTC
SQ  TTCCGCTCCTCTTCTCTTCCTGCAGCTGTATTTGAGTGTGCCCAGTCCGGCGCGCCAGCA
SQ  CAGCCTGGTACTCTCAGCATCCCTCGCACTCTCTTCACTTCCAACACTACTTTTCATGAT
SQ  CTATGTTTTCTTTTTCATAGCCAACTTTAGGCGGCCGCTTGGTGCTAGTGTTTGGGGGCG
SQ  ACGAGCAATTTTTTCAACGTGAGAAATATTTTGAAATGCTCTCCGTTCGAATACTTGTTG
SQ  GTATATGTA
SC  EMBL #Z34802; nt 25160-28888
XX
FT  1187 - 1202: MRS: large half site motif (16/16) [1]
FT  1387 - 1394: MRS: small half site motif (8/8) [1]
FT  2116 - 2131: MRS: large half site motif (15/16) [1]
FT  2122 - 2129: MRS: small half site motif (8/8), overlapping
FT                 the large half site [1]
FT  2308 - 2315: MRS: small half site motif (8/8) [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z34802; CEM88
XX
RN  [1]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
//