S/MARt DB - S/MAR

AC  SM0000229
XX
DT  14.12.1999 17:25:50 (created); ili
DT  15.12.1999 18:09:49 (updated); ili
XX
NA  CAEEL$MARf
XX
OS  Caenorhabditis elegans
OC  eukaryota; animalia; metazoa; nematoda; secernentea;
OC  rhabditia; rhabditida; rhabditina; rhabditoidea; rhabditidae
XX
SZ  1759 bp
XX
LO  3
DE  G001606; 
DC  overlaps with the promoter and the 5' region of the M88.6
DC  gene [1]
XX
SQ  GATCTTAATCAGTTTCCGATTTTTTAATTTTCTACCATAACCTTTCCTCGTGACGAGACC
SQ  CATCCGGATGACCATTCAAACAAATCCTTCCGTCTTCAATTACGAGCTTCTGTGAATTAA
SQ  GATTTTACGATCACCTGAATTTACGTCCAAGTTTCAACGATCTTATTCCTACCACATCGA
SQ  GTGAATCGTTAATATTTTTTATTTTTTTCTTCTTTTCTTCTTTGCCAGTACAAAAATATC
SQ  AAACCCTATCTCCTCATTTCTCAGAAACGTCGACATAAAATGCGAAGCTTACTCAGCTTC
SQ  GTCCTCCTGGCACTGGCCAGGATAGCAATTTCAGAAGAAACAAAAAGTTGTATTGATATT
SQ  GAGAAAGGATTCAAAGAAGAATTTAATGCACACAAACAGGTAAATTTTGGAATCGATTAA
SQ  CTCGACGGAGTTTGATAATATCCAAGAAAATACCTGTAACTTTTCAGCCAGTATGCATCT
SQ  GCGCCGACAACGGAATTTTCAGCACGGTCAAAGGATTTACTATAGAGTATGTTGAATTTT
SQ  ACTCGACTATAAAACTTCTTGAAACTGAAATTTTCTTTTCAGATGCGAATCCGCTTCAAT
SQ  TGCATCTGTATCTGAAAATTTGGCTTCACTGAATGGCACAGAATTGGGACGTCTCACAAT
SQ  AAGAGATTCTACAGTTAATGTTCTTCCACAGGATCTTTTTGAGAATGTAAGTTGAATTAC
SQ  AATAATGCCAATCAGGACAGAAACGTATATCACTAGTTAACTTTTTTCTCATCGCGGCGA
SQ  GACCCACTTAAATCAATCCAATTTTCAGGTCTTCGCTAAACAAGTTAAACTCGAACGATG
SQ  TGGTCTTTCAACTCTTCAACCAAATTCCTTCCAATCCCTTGGAGGATCAGCTGAATTATT
SQ  ATCTCTCCGCGAAAACAGAATTAAAAAACTGGAAAAGGGACTTTTCACTGGACTTAAAAG
SQ  TCTCAAAACTCTTGATTTGGCAATGAATAAGATTCAAGAAATTGATGTTGGAGCATTTGA
SQ  GGAATTGAAAAAAGTTGAAGAACTTTTACTCAATGAAAATGATATTCGAGTTTTGAAAAC
SQ  TGGAACATTTGATGGAATGAAGAATTTGAAGAAGTTGACACTTCAAAATTGCAATCTTGA
SQ  GATTATTCAAAAGTATTGTTTAATTTTTAAGAAAATAATATTTCAATAACCAAATATTTT
SQ  CAGAGGAGCATTCCGTGGTCTTAACTCTCTCGAACAGCTTATTCTATCAAATAACAATCT
SQ  TGAGAACATTGACTGGACAATCTTCTCAGCCTTGAAGAATCTTCGTGTACTTGATTTGGG
SQ  ATCAAACAAGATTTCCAATGTTGAGATGAAATCGTTCCCAAAACTTGAGAAATTGGTTCT
SQ  CAACAATAATACTATTGATTCAATGAAATCTATTAAGCTGAAGGGTTAGTTTTTCTACCT
SQ  TAAATAGTTTTTGTAGGCTAAAAATTATGGCCTCGGGTCCTGGCCCTATCGAAATTTTTT
SQ  ATATACCGTAAAAAATTAAAAAAACATTTAATCTTACGTTTGGAGAAATTTTCTCTCAAT
SQ  AATTGATAAATAAATTTTGAAAACTTTAAAAAATCGTAGATAACTAAAAAATAATCTCGG
SQ  GTACGGTAGATCAAAAGTTTTCCTCGTGCTAGGATCGAAGGTCGACATAAAAAATTACAC
SQ  ATGGTCGAAACTAAAATTTTTGTCTAACGATTCTTAATAGAATTATAATCCTTTTCGTAG
SQ  AATAAAAATAATTTATTCA
SC  EMBL #Z34802; nt 28889-30647
XX
FT  1250 - 1257: MRS: small half site motif (8/8) [1]
FT  1386 - 1401: MRS: large half site motif (15/16) [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: Z34802; CEM88
XX
RN  [1]
RX  MEDLINE; 99380480 PubMed; 10390535
RA  van Drunen, C. M., Sewalt, R. G. A. B., Oosterling, R. W.,
RA  Weisbeek, P. J., Smeekens, S. C. M., van Driel, R.
RT  A bipartite sequence element associated with
RT  matrix/scaffold attachment regions
RL  Nucleic Acids Res. 27:2924-2930 (1999)
RN  [2]
RX  MEDLINE; 20056261 PubMed; 10588722
RA  Greally, J. M., Gray, T. A., Gabriel, J. M., Song, L.,
RA  Zemel, S., Nicholls, R. D.
RT  Conserved characteristics of heterochromatin-forming DNA at
RT  the 15q11-q13 imprinting center
RL  Proc. Natl. Acad. Sci. USA 96:14430-14435 (1999)
//