S/MARt DB - S/MAR

AC  SM0000230
XX
DT  21.2.2000 16:51:51 (created); ili
DT  19.4.2002 15:32:00 (updated); ili
XX
NA  BOMMO$MAR1
XX
SY  BmMAR1, 
XX
OS  silk moth, Bombyx mori
OC  eukaryota; animalia; metazoa; arthropoda; insecta;
OC  lepidoptera; bombycoidea; bombycidae
XX
SZ  1983 bp
XX
SQ  GGATCCTAAATATGTTTACAAATAAGGTTCATAGTCTAAATGACTCATTTACTAATTGTT
SQ  TAGTGCTCAGTAAATACTATTCATGTATATATTATTTTTCTCCAAAAACTCAAGAAGTTC
SQ  GACATCAATCTTCAAGCTTATAACATCCTAACTCTGTTCGTGTAACATCAAAATCAAAAT
SQ  CAAAATCAAAAAATTTTTCAAAATCAAAATGCGTAACACAAACATAAAAATAAAAATAAA
SQ  TAAAATGTTTTTATGTTATTTAAGTAGACCTTTCCAGGAAACTTTGAATCATCATGACTT
SQ  TGCATTTGATACTACTCCGTATCAGTTTCTCTGTTGACAAAAATCAGCAATAGCTTAGGC
SQ  TTGAAAAATTTATAAACTACATTTATGACTATATATTTACATGATATGTTTGTCTGGATG
SQ  TTAATCAGGACATGCAGAGTCTCGTAAAGAGTCATCGTCCAACTACAATGCAGTTAATAC
SQ  TCGTATTCTCAATGAGCTTGGTACTTCATATGACCTAGTTAGTCATCTTGATTTTCAAAT
SQ  GTAATTTTATCTGCTATTTTTGATATTCATAATATAAATTACACGAAACATACAAACTAA
SQ  TTTCTGCAAACTTTTCAATTTACATGTTGCCGGGCAAGCTGACAGTGAATATATTAAAAG
SQ  TAATATTATGTATAACTTAAAACCGACAATAAACACACCTGTTTGTAGGCAGCTGCTTGG
SQ  TTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAACCACTCACCATCATGCGGGC
SQ  CGTATGCTCGTCTACCTACAAGGGCCCATAAAAAAGCATTTGAATTTGTCATTTGTTCAG
SQ  CCATAAAATTGTATTCTTCTTTACGAGTGACCGTTTCTTTAAAGCAACGGTAGGTATCTG
SQ  TGTGTTATCTTGTTATTTTTTCAAGTATTCTTTGAATAGATAATGCAGAAATAAAACGGA
SQ  TTTATCGCTAAACTTAGTTCCAAATAAGCAAAATTAAAATTGGGAGATACAGCGTATCGT
SQ  GAACCTATACTGGGAGGCACGACCGACCTGCCCATTATCATTATCCTGCCCTTCTCCCAG
SQ  TTACCTAGGGTCGGCGCAACATGTTTTCTCCTTCCATACTCTTCTATCATATACCATTTC
SQ  TTCGCTCACTCCCCTCTTACCCATATCGTCTTTCAAGCAATCCATCCATTTCTTCTTAAG
SQ  TCTACATCTTCCTCTATATCCTTCCACATTCATAGTTAATATTTTCTTACTAACCTCATT
SQ  TTCATTTCATCTCATCACATCTCCATACCATCCCAAACGCTCACTTCTCAGCTTCTCTGT
SQ  CACAGGTGCCACTTTCAGACTTCCTCTAACATATTCATTCCGTATTCTATCCATTCTCGT
SQ  TACTCCACACATCCATCGCGACATTCGCATCTCTGCTGCATGCCTTTCATCCGACCGACC
SQ  TGCCCATTATATAAATAATAAAATTGAGACACCTCATCTCTCAAAGTTGTTGGGGCCATC
SQ  CACGCTGTGATGTCTATGACTTTAACACGTGTCGAGTATGATAAACATTTTATTTTACCT
SQ  AAGAAATTCTATCTACGTTAGCAGGGATATGATAAAAGCATTGTCCAGACGAACTGAAAA
SQ  TCTGGTTATTTATTATTTATTATTAATAATACATTAAAATATTATACGGCCTGCAATTTT
SQ  AATCAATCTATGCTCAACAATTTGTGATAAGAAACCAGATAACATACAGATACGACAATT
SQ  AGATAATGAAATGAGTCAACTACTATCTCTGTTGCAATAATAAATGTTTTTATGTAATTT
SQ  AAAATGCATTTTATAACAACTTGTTGTGTTGAATAATAAAAAATTAGTCATTCAACAAAA
SQ  TGGGTACTATCCATTGTTGTAAAACAGATATGAGGCCTATAAAATCAAAGGCAGCTATAT
SQ  CCAAGTCTGTCAAATATTCAGGTAAACTACAAAAATCGGCCCTAAACACGTCATTACGGA
SQ  TCC
SC  EMBL #AF130337
XX
FT  335 - 1422: major attachment region [1]
XX
BP  60% [1]
XX
CP  silkglands [1]
CN  cephalosome, integumentum, cavitas corporeae excluding
CN  silkglands [1]
XX
EV  in vivo selection/high salt [1]
EV  re-binding assay (high salt) [1]
XX
DR  EMBL: AF130337; AF130337
XX
RN  [1]
RX  MEDLINE; 21488338 PubMed; 11602351
RA  Zhou, C.-Z., Liu, B.
RT  dentification and characterization of a silkgland-related
RT  matrix association region in Bombyx mori
RL  Gene 277:139-144 (2001)
//