S/MARt DB - S/MAR

AC  SM0000231
XX
DT  21.3.2000 13:56:13 (created); ili
DT  13.6.2001 15:31:00 (updated); ili
XX
NA  SHEEP$BLG-3MAR
XX
OS  sheep, Ovis aries
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; artiodactyla; ruminantia;
OC  pecora; bovidae
XX
SZ  899 bp
XX
LO  3p28 [1]
DE  G000817; beta-lactoglobulin
DP  Direction: 3'; 104 - 1002; Pos 1: poly(A+) signal
DC  caution: mentioned to locate to a 892 bp BamH I-BamH I
DC  fragment -95 to -985 relative to the polyadenylation signal
DC  in [1]
XX
SQ  GGATCCAGGGCGTCTGCATCACAGTCTTGTGACAACTGGGGGCCCACACACATCACTGCG
SQ  GCTCTTTGAAACTTTCAGGAACCAGGGAGGGACTCGGCAGAGACATCTGCCAGTTCACTT
SQ  GGAGTGTTCAGTCAACACCCAAACTCGACAAAGGACAGAAAGTGGAAAATGGCTGTCTCT
SQ  TAGTCTAATAAATATTGATATGAAACTCAAGTTGCTCATGGATCAATATGCCTTTATGAT
SQ  CCAGCCAGCCACTACTGTCGTATCAACTCATGTACCCAAACGCACTGATCTGTCTGGCTA
SQ  ATGATGAGAGATTCCCAGTAGAGAGCTGGCAAGAGGTCACAGTGAGAACTGTCTGCACAC
SQ  ACAGCAGAGTCCACCAGTCATCCTAAGGAGATCAGTCCTGGTGTTCATTGGAGGACTGAT
SQ  GTTGAAGCTGAAACTCCAATGCTTTGGCCACCTGATGTGAAGAGCTGACTCATTTGAAAA
SQ  GACCCTGATGCTGGGAAAGATTGAGGGCAGGAGGAGAAGGGGACGACAGAGGATGAGATG
SQ  GTTGGATGGCATCACCAACACAATGGACATGGGTTTGGGTGGACTCCAGGAGTTGGTGAT
SQ  GGACAGGGAGGCCTGGCGTGCTACGGAAGCGGTTTATGGGGTCACAAAGACTGAGTGACT
SQ  GAACTGAGCTGAACTGAATGGAAATGAGGTATACAGCAAAGTGGGGATTTTTTAGATAAT
SQ  AAGAATATACACATAACATAGTGTATACTCATATTTTTATGCATACCTGAATGCTCAGTC
SQ  ACTCAGTCGTATCTGACTCTGTGACCTATGGACCGTAGCCTTCCAGGTTTCTTCTGTCCA
SQ  CAGAATTCTCCAAGGCAAGAATACTGGAGTGGGTAGCCATTTCCTCCTCCAGGGGATCC
SC  EMBL #X12817; nt 5554-6452, release 35
XX
FF  enhances beta- lactoglobulin transcription in transfected
FF  cells [1]; seems not to contribute to hormonal
FF  responsiveness [1]
XX
EV  in vitro selection of S/MAR [1]
XX
DR  EMBL: X12817; OALGB
XX
RN  [1]
RX  MEDLINE; 20156394 PubMed; 10689189
RA  Whitelaw, C. B., Grolli, S., Accornero, P., Donofrio, G.,
RA  Farini, E., Webster, J.
RT  Matrix attachment region regulates basal beta-lactoglobulin
RT  transgene expression
RL  Gene 244:73-80 (2000)
//