S/MARt DB - S/MAR

AC  SM0000233
XX
DT  22.3.2000 17:27:26 (created); ili
DT  12.3.2004 11:53:00 (updated); ili2
XX
NA  GG$GLOBA-5MAR2
XX
SY  chicken pi-globin upstream MAR, 
XX
OS  chick, Gallus gallus
OC  eukaryota; animalia; metazoa; chordata; vertebrata; aves;
OC  neornithes; neognathae; galliformes; phasianidae
XX
SZ  1000 bp
XX
DE  G000046; alphaA-globin
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 3
DE  G000047; alphaD-globin
DP  Direction: 5'; Pos 1: ATG
DN  Internal: n; Gene position numeral: 2
DE  G001169; pi-globin
DP  Direction: 5'; 12000 - 11000; Pos 1: ATG
DN  Internal: n; Gene position numeral: 1

G001169;
pi-globin
G000047;
alphaD-globin
G000046;
alphaA-globin

XX
SQ  CCTCCAGAGCAACCTGGACTCCAGACACGTTCTCCTGGTCTGACAGCCTGGATTCATTGG
SQ  TTTGGTTGTCTGATCCTACCTCTCACCCCCCAAAACCACTGCACATGATTTATACGTTTC
SQ  TCAGGCCTCTGGATGACAGGGAGATTGAGGGACAGCAGATATGTCACTCCCATCATTTTA
SQ  TCTCAGACAATAAATATTTTAGTTTGGATATTTTAAAACTGGTTTTCTAATCTCTGCAGT
SQ  GCATTACAATGACATAAACACGTTAACTTACTGAAGCCCTTGAAGCAGATTGGGTTTCAC
SQ  AGTCAGGTTGTAACAGTCCCTACTGCCCCAGCATTAGCCTGAGCTCTGTGATTCTACAGG
SQ  GGAGCCAACCTTTCCTGTGCTATGGAGCTCAGCAGGCAGAAACTAAATACAGAAAGCAGA
SQ  AGTTTTGATTTGCCCAGAATATCCTACCTCTCCTATCATGAGCTCAACACAGTGTGCAGC
SQ  CACAGCACACAGTCCTGCAGGATGACACAAACCACACCAGTGCAGGCTGCCTACTGCCAC
SQ  CAGCACCTCCTCTGGAACTGGCACAGCTGAAACAACAGAGCCTTTGCCTTAGCATGCAGA
SQ  CAAGAGGGGGAAAGTATCTCAAACAGAACTTCAGTGTTTCCCCAAGCATGGATAATCACT
SQ  TTTAAAGTGCCATAGAAATTCAAAAATTCTTTATAATTTTCAAATTACAAAGAATTTGTA
SQ  TTCGAGGTAGGGTAGAGGGGGAGCTGACTATTTAGGTGACCATCTTTATGCTACACGAGG
SQ  ACTAGAAATGTATTTCAATACTTTTGGGCCCTCGGCATGTTCAGGAAGGGGCTATAATGC
SQ  AGTTGTCAGTTCAGCTTAGAAGGGCATCAGGAAGGAGCAGCTGCTCACAAACAGCTCTGC
SQ  AACGAGCTCTGCATAATTATTGTGAGATTATAAATAGTTCAGTCACTCATCTGTACTTTT
SQ  TGGTCATTGCTTGTCAGAAGGCAATTTGCCTCAGGGATCC
SC  EMBL #AF067138; nt 3112-4111, release 56
XX
SF  contains AT-motifs, inverted repeats and putative
SF  transcription factor binding sites [1]
XX
CP  liver [1]
XX
EV  in vitro selection of S/MAR [1]
EC  efficient matrix binding was observed only with matrices
EC  prepared form chicken liver nuclei [1]
XX
DR  EMBL: AF067138; AF067138
XX
RN  [1]
RX  MEDLINE; 20162112 PubMed; 10698286
RA  Pietrowska, M., Rusin, M., Widlak, P., Razin, S. V.,
RA  Rzeszowska-Wolny, J.
RT  Characterization of DNA sequences localized 11 to 17.5 kb
RT  upstream of the chicken embryonic pi-globin gene
RL  Acta Biochim. Pol. 46:777-784 (1999)
//